Emesis (Emesis) fatimellina, Grishin, 2024

Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V., 2024, Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae), Insecta Mundi 2024 (82), pp. 1-48 : 8-9

Emesis (Emesis) fatimellina Grishin, new species

http://zoobank.org/ FAE56D8B-3EF1-4E43-B997-CB21188D67C7

( Fig. 1 part, 15–16, 81–82)

Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that two specimens from Southeast Brazil and South Brazil ( Fig. 1 red) form a clade sister to both Emesis (Emesis) nobilata Stichel, 1910 , new status (type locality in Costa Rica) and Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) and are genetically differentiated from their relatives ( Fig. 1 cyan, blue, and magenta) at the species level, e.g., their COI barcodes differ by 4.1%–4.6% (27–30 bp). Therefore, these specimens represent a new species. This new species is phenotypically similar to E. nobilata and E. fatimella and differs from its relatives by the ground color that is paler and more orange than in E. nobilata , but yellower (rather than orange) beneath compared even to E. fatimella , sharper defined and less diffuse dark markings on the dorsal side, and generally smaller submarginal brown spots on the ventral side; these spots are not all the same size and the size difference among them appears more pronounced than in other species. In male genitalia ( Fig. 81–82 ), the lower valval projection is not developed, the upper projection is claw-like with the inner broad tooth, aedeagus terminally with several stronger sclerotized broad teeth around the posterior margin. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne11524.2.14:G153A, cne877.3.6:T267C, cne764.2.12:C144T, cne764.2.12:C154A, cne6813.1.17:G103T, and COI barcode: A1T, T169A, T232C, A433T, T526C, T646C.

Barcode sequence of the holotype. Sample NVG-18044H01, GenBank PQ203547, 658 base pairs: TACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATCTTTAATTGGCGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGCGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCCTTCCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCATCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC

CCCACTTTCATCTAATATTGCTCATGGTGGATCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATT TTAGGTGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAT CAGTAGGAATTACCGCTCTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 15–16 , bears the following six printed (text in italics handwritten) rectangular labels, five white: [ Brasil: Santa Catarina | Joinville: 10-200 m | 26 Feb 1991 | Leg. H. Miers], [DNA sample ID: | NVG-18044H01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-23114G04 | c/o Nick V. Grishin ], [genitalia | NVG240817-09 | Nick V. Grishin ], [USNMENT | {QR Code} | 01466402], and one red [HOLOTYPE ♂ | Emesis (Emesis) | fatimellina Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1♂: NVG-18052G08 Brazil: Rio de Janeiro, Teresópolis, coll. H. Stichel number 3305 [ MFNB].

Type locality. Brazil: Santa Catarina, Joinville.

Etymology. The name is formed from the name of its South American relative, E. fatimella , which is made longer for this more southern species and is treated as a feminine noun in apposition.

Distribution. Southeast and South Brazil.

Figures

Figure 1. Phylogenetic trees of Emesis (Emesis) species inferred from protein-coding regions in a) the nuclear genome (autosomes), based on 4,040,316 positions, b) the Z chromosome, based on 247,785 positions, and c) the mitochondrial genome: E. cereus (purple), E. cronina stat. rest. (green), E. aerunda sp. n. (orange), E. orichalceus (olive), E. bartica sp. n. (aquamarine), E. aerigera (brown), E. nobilata stat. nov. (cyan), E. panamella sp. n. (magenta), E. fatimella (blue), and E. fatimellina sp. n. (red). Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. For each specimen, the name adopted in this work is given first, and a comment about the previous taxonomic placement (if different) is shown in square brackets, supplemented with the DNA Sample number, type status (see Materials and Methods for abbreviations), general locality, and year of collection. See Table S1 in the supplemental file (Zhang et al. 2024a) or NCBI database entries for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym if the synonym name is provided. The same notations are used throughout this work in other figures showing phylogenetic trees.

Figures 81–106. Genitalia of holotypes (unless indicated) of Emesis (Emesis), Emesis (Mandania), and Emesis (Tenedia), data in text. In Fig. 81–132, left lateral and ventral views are denoted by odd and even numbers, respectively (except 87, 91, 95, and 101, which are ventral); complete genitalia are illustrated, sometimes with parts removed and shown separately (as stated); for females, only the sternite VII (“genital plate”) (88, 92, 96, 102) is shown to scale and complete genitalia are at half the size, as indicated by the smaller scale bar. 81–82) E. (E.) fatimellina sp. n. 83–84) E. (E.) panamella sp. n. 85–88) E. (M.) russula sudesta ssp. n. paratypes: 85–86) NVG-18045H11 and 87–88) NVG-18044F07. 89–90) E. (M.) russula russula non-type specimen NVG-18044D11. 91–92) E. (M.) mandora sp. n. 93–94) E. (M.) manduza sp. n. 95–96) E. (T.) nimia sp. n. 97–98) E. (T.) faria sp. n. 99–102) E. (T.) leona sp. n.: 101–102) Paratype NVG-10598. 103–104) E. (T.) subangularis sp. n. 105–106) E. (T.) angularis non-type specimen NVG-23115A11.

Figures 7–26. Holotypes (unless indicated) of Emesis (Emesis) and Emesis (Mandania), data in text. In Fig. 7–80, dorsal and ventral sides are denoted by odd and even numbers, respectively (except 42 and 44, which are dorsal); type status and sex are shown in each view, F indicates flipped image (left-right inverted). 7–8) E. (E.) aerunda sp. n. 9–10) E. (E.) orichalceus non-type specimen NVG-18045D03. 11–12) E. (E.) aerigera syntype NVG-18054D07. 13–14) E. (E.) bartica sp. n. 15–16) E. (E.) fatimellina sp. n. 17–18) E. (E.) panamella sp. n. 19–22) E. (M.) russula sudesta ssp. n.: 21–22) Paratype NVG-18045H11. 23–24) E. (M.) mandora sp. n. 25–26) E. (M.) manduza sp. n.