Milnesium tardigradum
|
publication ID |
https://doi.org/10.5281/zenodo.214356 |
|
DOI |
https://doi.org/10.5281/zenodo.5612865 |
|
persistent identifier |
https://treatment.plazi.org/id/03A987E9-733D-FFC8-1AB7-7177FBDCE18D |
|
treatment provided by |
Plazi |
|
scientific name |
Milnesium tardigradum |
| status |
sensu stricto |
Milnesium tardigradum sensu stricto Doyère, 1840
( Figs 12–15 View FIGURE 12 View FIGURES 13 – 15 , Table 3 View TABLE 3 )
Material examined. Neotype, 46 neoparatypes (all females), 2 exuvia with eggs mounted in Hoyer’s medium and eight additional specimens used for molecular analysis ( COI and ITS2 region sequencing): Zeesen, Wildau, Germany, 52°16'52''N and 13°38'23''E, 37 m asl, moss and lichen sample from a roof, 11.02.2011, coll. Marcus Frohme.
Description (measurements in Table 3 View TABLE 3 ). Body white/transparent in small individuals and yellowish to brownish in large ones. Eyes were present in 70% of examined individuals (fixed in Hoyer’s medium). Cuticle smooth, without granulation or pores ( Fig. 12 View FIGURE 12 ). Two lateral and six peribuccal papillae present (ventral papilla smaller than other papillae).
Buccal apparatus of the Milnesium type ( Fig. 13 View FIGURES 13 – 15 ). Six peribuccal lamellae around the mouth opening present. Buccal tube cylindrical (anterior and posterior diameters similar). Pharyngeal bulb elongated, pear-shaped and without placoids or septulum.
Claws of the Milnesium type, slender ( Figs 14–15 View FIGURES 13 – 15 ). Primary branches on all legs with small, but distinct accessory points detaching from the branch at its greatest curvature. Secondary branches with rounded basal thickenings. Secondary branches of external claws I–III and posterior claws IV with two points, and secondary branches of internal claws I–III and anterior claws IV with three points (i.e. claw configuration: [2-3]-[3-2]). Single, long transversal, cuticular bars under claws I–III present ( Fig. 14 View FIGURES 13 – 15 ).
CHARACTER N RANGE MEAN SD Neotype
µm pt µm pt µm pt µm pt Posterior base + secondary branch 14 16.0 – 10.6 44.9 – 36.2 13.7 40.3 1.5 2.1 10.6 36.2 Eggs are oval, smooth and deposited in exuvium (in the two exuvia we found there were 6 and 8 eggs respectively).
AGATATTGGGATATTATATTTTATTTTTGGTATTTGATGTGCTTTTGGTGGATCAGCCTTAAGTATGTTAATTCGT CTTGAGTTGTCTCAACCTAATACAATACTAATAAGTGAAGATATTTATAATGCGTTTATTACAAGTCATGCATTAG TAATAATTTTTTTTTTTGTTATACCTGTTTTAATTGGGGGCTTTGGAAATTGATTAGTTCCTTTAATAATTAGTTC ACCAGATATAGCTTTTCCACGAGTTAATAATGTCAGATTTTGAATATTGGTTGCTTCATTTATGTTATTAGTGTAT AGAATATTTTGTGGAGAGGGTGTTGGTGCTGGTTGGACTCTTTACCCTCCATTAACTAATATTTATGGCCATAGAA GAACAGCAGTTGATTATGCAATTTTATCATTACACATTGCTGGTGCTTCTTCTATTTTTAGAGCTATGAATTTTTT AACTACAATTTTTAATATACATTATTTTGGAGTTCGTATAGATAAGTTGCCTTTATTTGTTTGGTCAATTTTTATT ACAGCCTTGTTATTAGTGTTAGCTCTTCCGGTATTGGCTGGGGCTATTACTATATTGATTGCAGATCGTAATTTTG ATACTTCCTTTTTTGATCCTGCAGGGGGAGG
AACGAAAATAAACCTGATAGCTACGTGTTTGCTATCGATTGTTTGTCATTCTCTACTGGCCTGCTTCTGTCTTCTC AGAGCAGAGCCAGGTTAAGGCTGACAGATGAAGTTTCGACCCTATGACGAGCGTGCTTCTTGATCTGTAGCAGATC GGAAGCCGACGCGTATCCATACATTTTGTGTACAAAGGACTGTATGATGAAAGTAGGTTGGCGGTCGCTGATGGGC GCTCTATTATCGCTTAGCTAGCAGTGCATGCGGCAGTTTTGCACAGATTGCTAGCGGTGTTTAGAGACGCTTGGCT AACCGAACGACAGTCCATTTTCCTTGTACGCAATCGGTATTGGAGCCATACGCGCTTCGGCTTTGAGTACAGATAT CAGTACGCTGAATTGTCATAGGTTGTAGACTGTATGCGTGCTTAACGCGTTACACACTCATTACGT
Neotype locality. Zeesen, Wildau, Germany, 52°16'53''N and 13°38'23''E, 37 m asl, moss and lichen from a roof.
Distribution. All previous records of M. tardigradum will now need to be re-examined; therefore not much can be stated regarding the species geographic distribution. Nevertheless, we can hypothesise that M. tardigradum s.s. is likely to be found throughout Europe, but it may also have a wider, Palearctic or Holoarctic range. Etymology. Louis Doyère named the genus after a French zoologist, Henri Milne-Edwards. The specific name comes from Spallanzani (1777), who first described specimens of Milnesium as ‘Tardigrado’.
Type depositories. Neotype and 46 neoparatypes mounted in Hoyer’s medium are preserved at the Department of Animal Taxonomy and Ecology, A. Mickiewicz University, Umultowska 89, 61-614 Poznań, Poland.
Comparison with the original description. Specimens we designated as a new type series correspond well with the description and drawings in Doyère (1840). The cuticle appears to be smooth, buccal tube cylindrical and the claw configuration is [2-3]-[3-2]. Although in Doyère (1840) the claws were drawn without accessory points, we have assumed they were present M. tardigradum s.s., and have based our assumption on two reasons: (1) Doyère (1840) did not draw accessory points in any of his figures (e.g. all known Ramazzottius and Macrobiotus species have accessory points, whereas in Doyère’s drawings of these genera such structures were not shown); (2) only five, of seventeen known Milnesium species, do not have accessory points and none of these were for European records.
Differential diagnosis. Apart from M. tardigradum s.s., there are four other described Milnesium species with the claw configuration [2-3]-[3-2]. M. tardigradum s.s. differs specifically from:
M. krzysztofi by having smooth dorso-lateral cuticle (reticulated in M. krzysztofi ).
M. reductum Tumanov, 2006 by the presence of accessory points on the primary branches of claws (accessory points absent in M. reductum ).
M. reticulatum by having smooth dorso-lateral cuticle (reticulated and with gibbosities in M. reticulatum ) and six peribuccal lamellae (four in M. reticulatum ).
M. tetralamellatum by having six peribuccal lamellae (four in M. tetralamellatum ).
In other words, smooth cuticle, the presence of accessory points on the primary branches of all claws, six peribuccal lamellae and cylindrical buccal tube create a unique combination of characters within the group of Milnesium species with the [2-3]-[3-2] claw configuration. Thus, we conclude that it is most unlikely that any synonym species of M. tardigradum s.s. have been described since Doyère (1840).
TABLE 3. Measurements and pt values of selected morphological structures of fifteen randomly chosen specimens from the neotype population of Milnesium tardigradum s. s. (N = number of specimens or structures measured; RANGE = the smallest and the largest structure found among all specimens measured; SD = standard deviation).
| Body length | 15 | 605 – | 330 | 1609 | – | 1078 | 454 | 1314 | 81 | 153 | 334 | 1140 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Peribuccal papillae length | 12 | 9.0 – | 6.0 | 24.4 | – | 20.4 | 7.8 | 22.5 | 1.0 | 1.5 | 6.3 | 21.5 |
| Lateral papillae length | 9 | 5.7 – | 4.5 | 17.2 | – | 13.8 | 5.0 | 15.0 | 0.4 | 1.1 | 4.5 | 15.4 |
| Buccal tube | ||||||||||||
| Length | 15 | 39.4 – | 29.3 | – | 34.3 | – | 3.0 | – | 29.3 | – | ||
| Stylet support insertion point | 15 | 26.5 – | 19.1 | 67.3 | – | 63.5 | 22.5 | 65.4 | 2.0 | 1.3 | 19.7 | 67.2 |
| Anterior width | 15 | 16.6 – | 10.7 | 48.2 | – | 36.5 | 14.0 | 40.7 | 1.8 | 3.5 | 10.7 | 36.5 |
| Standard width | 15 | 16.8 – | 10.2 | 44.7 | – | 34.8 | 13.2 | 38.4 | 1.8 | 2.9 | 10.2 | 34.8 |
| Posterior width | 15 | 18.0 – | 10.2 | 47.9 | – | 34.8 | 14.0 | 40.7 | 2.1 | 3.7 | 10.2 | 34.8 |
| Standard width/length ratio | 15 | 45% – | 35% | – | 38% | – | 3% | – | 35% | – | ||
| Posterior/anterior width ratio | 15 | 108% – | 93% | – | 100% | – | 5% | – | 95% | – | ||
| Claw 1 lengths | ||||||||||||
| External primary branch | 11 | 18.4 – | 13.3 | 49.4 | – | 43.0 | 15.7 | 46.2 | 1.7 | 1.9 | 13.4 | 45.7 |
| External base + secondary branch | 10 | 12.5 – | 9.3 | 35.1 | – | 29.9 | 11.1 | 32.9 | 1.0 | 1.7 | 9.3 | 31.7 |
| Internal primary branch | 10 | 17.4 – | 12.4 | 48.3 | – | 41.0 | 15.0 | 43.6 | 1.5 | 2.3 | 12.4 | 42.3 |
| Internal base + secondary branch | 10 | 12.8 – | 9.8 | 34.2 | – | 32.0 | 11.3 | 33.1 | 1.1 | 0.9 | 9.8 | 33.4 |
| Internal spur | 10 | 4.3 – | 2.7 | 12.4 | – | 7.7 | 3.5 | 10.2 | 0.5 | 1.7 | 3.4 | 11.6 |
| Claw 2 lengths | ||||||||||||
| External primary branch | 15 | 19.8 – | 13.4 | 52.7 | – | 44.9 | 16.8 | 48.8 | 2.0 | 2.6 | 13.7 | 46.8 |
| External base + secondary branch | 12 | 14.0 – | 9.7 | 37.2 | – | 33.1 | 12.0 | 35.1 | 1.3 | 1.4 | 9.7 | 33.1 |
| Internal primary branch | 15 | 18.6 – | 13.1 | 49.7 | – | 43.4 | 16.0 | 46.7 | 1.7 | 1.9 | 13.5 | 46.1 |
| Internal base + secondary branch | 11 | 13.3 – | 10.2 | 36.0 | – | 32.3 | 11.7 | 34.6 | 1.1 | 1.2 | 10.2 | 34.8 |
| Internal spur | 10 | 4.6 – | 2.7 | 13.9 | – | 9.2 | 4.0 | 11.8 | 0.5 | 1.5 | 3.9 | 13.3 |
| Claw 3 lengths | ||||||||||||
| External primary branch | 13 | 19.7 – | 14.2 | 52.4 | – | 45.9 | 17.0 | 49.5 | 1.8 | 1.7 | 14.3 | 48.8 |
| External base + secondary branch | 10 | 13.5 – | 9.9 | 37.4 | – | 33.8 | 12.1 | 35.6 | 1.2 | 1.0 | 9.9 | 33.8 |
| Internal primary branch | 12 | 17.7 – | 12.8 | 48.3 | – | 43.1 | 15.9 | 46.3 | 1.6 | 1.8 | 12.8 | 43.7 |
| Internal base + secondary branch | 12 | 13.7 – | 9.5 | 37.1 | – | 32.4 | 11.7 | 34.5 | 1.1 | 1.6 | 9.5 | 32.4 |
| Internal spur | 12 | 5.6 – | 3.1 | 16.1 | – | 10.5 | 4.3 | 12.7 | 0.7 | 1.7 | 4.1 | 14.0 |
| Claw 4 lengths | ||||||||||||
| Anterior primary branch | 13 | 22.3 – | 16.4 | 62.9 | – | 52.6 | 19.5 | 57.6 | 2.1 | 2.9 | 16.8 | 57.3 |
| Anterior base + secondary branch | 13 | 15.0 – | 10.3 | 40.7 | – | 32.7 | 12.8 | 37.7 | 1.4 | 2.3 | 10.3 | 35.2 |
| Anterior spur | 12 | 4.9 – | 3.2 | 14.8 | – | 10.9 | 4.1 | 12.2 | 0.6 | 1.2 | 3.6 | 12.3 |
| Posterior primary branch | 14 | 25.0 – | 16.8 | 67.9 | – | 55.6 | 20.7 | 60.9 | 2.5 | 3.6 | 17.3 | 59.0 |
| COI |
University of Coimbra Botany Department |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
Milnesium tardigradum
| Michalczyk, Łukasz, Wełnicz, Weronika, Frohme, Marcus & Kaczmarek, Łukasz 2012 |
M. reductum
| Tumanov 2006 |
