Dna

Mennesson, Marion I., Charpin, Nicolas & Keith, Philippe, 2024, Fish conservation: importance of DNA reference library based on accurately identified specimens. The case of New Caledonian freshwater fish, Cybium 48 (3), pp. 187-193 : 190

DNA barcode sequencing

Each specimen caught was sequenced. Total DNA was extracted using Macherey and Nagel NucleoSpin® Tissue kits following the manufacturer’s instructions on an Eppendorf EpMotion 5075®.

As the aim of our project was to give access to the partial 12 S ribosomal RNA sequence (i.e, the marker most often used for e DNA studies) and the partial COI gene commonly used for barcoding, a part of the mitochondrial genome (called in this study ‘Mt-1’ for ‘the first part of the mitogenome’ starting from the middle of the 12 S to the tRNA-Ser after the COI gene) was amplified following the protocol established by Hinsinger et al. (2015) using the specific primers 12S-L1091R 5’ AAACTGGGATTAGA- TACCCCACTAT 3’ ( Kocher et al., 1989) and MtH7061 5’ GGGTTATGTGGCTGGCTTGAAAC 3’( Hinsinger et al., 2015). The Mt-1 fragment provides the sequence of 12 S gene [around 500 bp] and the complete COI gene. Ampli-

con libraries ( Hinsinger et al., 2015) were then sequenced on an Illumina MiSeq sequencer following the manufacturer’s instructions.

When the Mt-1 fragment reconstruction was difficult, a fragment of the COI gene was amplified with the specific fish primers TelF1 and TelR1 ( Dettaï et al., 2011) and used as a reference.

Data processing was done in Geneious v.11.1.2 (http:// www.geneious.com, Kearse et al., 2012). To reconstruct the Mt-1 fragment of each individual, we used the mtDNA of the species identified morphologically or of the same genus (personal data or sequences available on GenBank) as a starting reference (i.e., for a Map to reference). For the species that had not been sequenced yet at the time of our project, such as, for example, Bleheratherina pierucciae Aarn and Ivantsoff, 2009 , a piece of the COI gene was obtained by Sanger sequencing and then used as a starting reference. The consensus of each Mt-1 fragment was primarily checked manually (assembly success, coverage assessment, comparison to available COI sequences for the same specimen, BLAST searches; Altschul et al., 1997). Then the consensus sequence was annotated using MitoAnnotator ( Iwasaki et al., 2013) and each gene was checked for coding sequences, stop codons, position of the SNPs.