Euriphellus panador Grishin, 2023
|
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
|
persistent identifier |
https://treatment.plazi.org/id/03810139-FFD6-BB5A-C0CA-FB18E0C8B1F9 |
|
treatment provided by |
Felipe |
|
scientific name |
Euriphellus panador Grishin |
| status |
sp. nov. |
Euriphellus panador Grishin , new species
https://zoobank.org/ 2CF28569-39B0-4379-9C26-25992D63BFFA
( Fig. 1 part, 11–12, 223–224)
Definition and diagnosis. Among the clades representing named species of the Euriphellus phraxanor (Hewitson, 1876) group, we see a clade, sister to both E. phraxanor and Euriphellus mena ( Evans, 1952) ( type locality in Ecuador) that was not associated with any available name and therefore consists of new species ( Fig. 1). One of these new species (see below for the second one) keys to “ Dyscophellus phraxanor phraxanor ” (D.4.2(b)) in Evans (1952) but differs from it and other relatives by a combination of flatter and narrower tegumen in lateral view, the sharper and terminally narrower basal tooth of harpe, ventral margin of harpe being only slightly shouldered ( Fig. 224), but more so than that in the new species described next ( Fig. 226), moderately defined hindwing discal spots, which are brown on the dorsal side, not hyaline, spot in cell M 2 -M 3 offset basad from the row, comparatively (to the ventral hindwing discal yellow spots) larger forewing subapical spots, and weaker orange overscaling in the anterior part of ventral forewing ( Fig. 11–12). COI barcode of this new species differs from E. phraxanor and E. mena by 4.7% (31 bp) and 4.6% (30 bp), respectively, but only 1.4% (9 bp) different from Euriphellus lama ( Evans, 1952) ( type locality in Guatemala), while being well differentiated from it in the Z chromosome ( Fig. 1a). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly151.14.2:A75G, aly 2090.1.4:A54G, aly127.43.4:G102A, aly127.43.4:A160G, aly443.22.1:C88A, and COI barcode: A181G, T259C, T364C, T376A, T553A.
Barcode sequence of the holotype. Sample NVG-17104C12, GenBank OR837625, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATT GGAAATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACT GATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAAT TTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGCCCATCAAGGATCATCAGTTGATTTA GCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCTT
TCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATT AACAGACCGAAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 11–12, bears the following four rectangular labels, three white: [ ECUADOR: Esmeraldas | La Chaquita Exp Station | 10 Km San Lorenzo-Lita Road | 01° 13.82′S, 78° 45.95′W | 3 March 2001, 50 m | D.H. Ahrenholz leg.], [DNA sample ID: | NVG-17104C12 | c/o Nick V. Grishin], [USNMENT | { QR Code} | 00913861], and one red [ HOLOTYPE ♂ | Euriphellus | panador Grishin ] GoogleMaps . Paratype: 1♂ NVG-17104C11, USNMENT_00913860 Panama, Darien Province, Cana (Cerro Pirre), elevation 400 m, GPS 7.9333, −77.5667, 6-Jul-1981, G. B. Small leg. [ USNM].
Type locality. Ecuador: Esmeraldas Province, km 11 of San Lorenzo-Lita Road, La Chiquita Wildlife Refuge, elevation 50 m, GPS 1.23033, −78.76583.
Etymology. The name is a fusion of this species’ known localities: Pana [ma and Ecua] dor. The name is a noun in apposition.
Distribution. Currently known from Ecuador and eastern Panama.
Comment. Sequencing of the Telegonus mutius Plötz, 1882 (type locality in Colombia) syntype we found in MFNB reveals that it is conspecific with a syntype of Telegonus heras Mabille, 1888 (type locality Venezuela: Porto Cabello), currently a junior subjective synonym of Euriphellus phraxanor (Hewitson, 1876) (type locality “ New Granada ”—likely referring to Colombia —and Panama: Chiriquí) ( Fig. 1), thus confirming our previously hypothesized synonymy of T. mutius with E. phraxanor ( Zhang et al. 2022b) . We are currently undertaking a search for syntypes of E. phraxanor to complete this investigation.
| USNM |
Smithsonian Institution, National Museum of Natural History |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
