identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
03DB87BDAA6E3E59FF52F8F2FC35F8B0.text	03DB87BDAA6E3E59FF52F8F2FC35F8B0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Coccinellidae Latreille 1807	<div><p>Family Coccinellidae Latreille, 1807 Subfamily Epilachninae Mulsant, 1846 Tribe Epilachnini Mulsant, 1846</p> <p>Genus Diekeana Tomaszewska and Szawaryn, 2015 Diekeana Tomaszewska and Szawaryn, 2015: 562. Type species: Epilachna alternans Mulsant, 1850 (orig. descr.).</p> <p>Epilachna Chevrolat in Dejean, 1837 (e.p.); Szawaryn et al., 2015: 552, 562, 566.</p> <p>Diagnosis. (modified from Tomaszewska and Szawaryn, 2016). Genus Diekeana can be distinguished from other genera of Coccinellidae by following characters: body oval, strongly convex dorsally, with surface pubescent; head without dorsal antennal grooves; antennomere 1 shorter (less than 1/3 of total length of antenna); eyes with inner orbits closer posteriorly; mandibular incisor edge multidentate; prothoracic hypomeron simply punctate, prosternal process with lateral carinae; metaventral postcoxal lines joined on metaventral process; inner margin of metanepisternum with serration; mid and hind coxae simple without tubercles; tibiae without oblique carina near apex and coxites being spindle-shaped; claws do not form cordate pattern.</p> </div>	https://treatment.plazi.org/id/03DB87BDAA6E3E59FF52F8F2FC35F8B0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Jung, Sang Woo;Kim, Chan Shin and Yoon-Ho	Jung, Sang Woo, Kim, Chan Shin and Yoon-Ho (2023): New report of Diekeana insignis (Gorham, 1892) (Coleoptera: Coccinellidae: Epilachnini) in South Korea. Journal of Species Research 12 (3): 240-243, DOI: 10.12651/JSR.2023.12.3.240
03DB87BDAA6E3E5AFCD0F8D2FC12F89A.text	03DB87BDAA6E3E5AFCD0F8D2FC12F89A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Diekeana insignis (Gorham 1892)	<div><p>Diekeana insignis (Gorham, 1892) (Figs. 1-9)</p> <p>남ǧṞṪŖṜḏNj</p> <p>Epilachna insignis Gorham, 1892: 84 (orig. descr.); Pang et al., 2012: 13 (note).</p> <p>Epilachna fairmairei Frivaldszky, 1892: 121 (descr.).</p> <p>Diagnosis. Adults of D. insignis can be recognized by the following combination of characters: Body length 9.4 mm, width 7.8 mm (one male), oval, and strongly convex dorsally, with yellowish pubescence. Dorsum (Fig. 1) reddish brown with several large black markings. Head (Fig. 2) reddish brown, concealed under pronotum; clypeus narrow, not projecting in front of eyes; antennae short, as long as head width, with 11 antennomeres; antennomere 1 large and stout; antennomere 2 more or less stout, 1/2 length of antennomere 1; antennomere 3 long and slender; antennomeres 4 and 5 slender, shorter than antennomere 3, equal in length; antennomeres 6-8 shortest, equal in length; antennomeres 9-11 elongate, truncate at apex. Mandibles longer than wide, multidentate (more than three long teeth, with several small teeth in dorsal and apical view). Maxillae (Fig. 3) large; maxillary palp with four palpomeres; palpomere 1 slender; palpomere 2 longer than wide, more or less stout; palpomere 3 shortest and stout; palpomere 4 broadly securiform. Labial palps slender, with three palpomeres; approximate ratio of palpomeres as 1.0: 3.0: 3.5. Pronotum (Fig. 4) wider than long, with transverse large black marking in middle part; anterior angle protruding and rounded, posterior area broad and rounded. Scutellum visible, triangular, with fine punctures. Elytra reddish brown, convex dorsally, densely pubescence; each elytron with seven large black markings. Prosternum and hypomeron finely punctate; prosternal process (Fig. 5) longer than wide, with two carinae, round at apex. Legs short and flattened; femora widened; tibiae slender, tibial spur formula 1-2-2; mid and hind tibiae without carina; tarsal formula 4-4-4; tarsomeres 1 and 2 large, lobed ventrally; tarsomere 3 shortest; tarsomere 4 elongate and cylindrical; tarsal claws long and bifid. Abdomen (Fig. 6) with six ventrites, wider than long; abdominal postcoxal line incomplete, ending at 1/3 length of abdominal ventrite I, not reaching posterior margin of ventrite; abdominal intercoxal process wide; abdominal ventrites I- VI with punctate; abdominal ventrite V longer than ventrite VI, slightly emarginate in middle part; abdominal ventrite VI (Fig. 7) narrowest, with densely setae, more or less wide emarginate in middle part. Male genitalia as figured (Figs. 8, 9).</p> <p>Material examined. KOREA: 3♂, Gyeongsangnam-do, Changwon-si, Masanhappo-gu, Gapo-ro, 11.vii. 2021, leg. S.B. Son &amp; I.C. Shin; 1♂, Gyeongsangnam-do, Geoje-si, Dongbu-myeon, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=128.58815&amp;materialsCitation.latitude=34.799564" title="Search Plazi for locations around (long 128.58815/lat 34.799564)">Osong-ri</a>, (34°47′58.44″N, 128°35′17.36″ E, 24 m a.s.l.), 3.v.2022, leg. S.W. Jung &amp; Y.H. Kim.</p> <p>Distribution. Korea (South), China (Anhui, Fujian, Guangdong, Guangxi, Guizhou, Hainan, Henan, Hubei, Jiangxi, Shaanxi, Sichuan, Yunnan).</p> <p>Mitochondrial DNA (mtDNA) sequence of Diekeana insignis. Total 829 bp (accession number OQ706052) COI showing 99.25% similarity to the reference sequence of the Epilachna insignis (accession number KP123271.1)</p> <p>from China. The partial mitochondrial cytochrome c oxidase subunit I (COI) gene sequence is shown in the below: ACATCCGGAAGTTTATATTTTAATTCTTCCT G G AT T T G G A ATA AT T T C T C ATAT TAT TA G C CAAGAAAGAGGGAAAAAAGAAGCTTTTGGCT CATTAGGAATAATTTATGCTATAATAGCAATTG GATTACTAGGATTTGTAGTTTGAGCTCAT CATATATTTACAGTAGGAATAGATGTTGACACTC GAGCTTATTTTACCTCAGCAACAATAATTATTG C A G T T C C TA C T G G TAT TA A A AT T T T T T C AT GATTAGCAACTCTTCATGGAGTTCAATTTA ATTTTAGACCTTCACTTTTTTGAGTTCTAG GATTTTTATTCTTATTTACAATTGGTGGATTA A C A G G A G T T G TAT TA G C A A AT T C AT C TAT T G ATAT TAT T C T T C AT G A C A C ATA C TAT G T T G TA G C T C AT T T T C AT TAT G T T C T T T C A ATA G G GGCCGTTTTTGCAATTATAGCCGGATTTGTC CATTGATTTCCTTTATTTACAGGTTTTAATCT TAACAGAAAACTTTTAAAAATTCAATTTATTG TAATATTTATTGGAGTAAACTTAACTTTTTTC CCTCAACATTTTTTAGGGTTAGCAGGTATAC CCCGACGATATTCTGATTATCCAGATGCTTATTTA ATGTGAAATAAAATTTCCTCTATTGGATCAATA ATTTCTTCTATTAGAATTATTTTTTTTATATTA ATTATTTGAGAAAGATTTTATAGATTCCGTATA A G A AT TATA A G A AT TA G A ATA C C T T C C T TA ATAGAATGATTTCAATTAACTCCTCCAAATGAA CATAGATATTCAGAAATTCCTATACTGTCAATA ATTTTC</p> <p>Remarks. Gorham (1892) described Epilachna insignis based on the collection on Mr. Pratt in China (Kiu-kiang) as a new species. Pang et al. (2012) reported 20 species of Chinese Epilachna Chevrolat including E. insignis, with digital illustrations of the habitus, male and female genitalia. However, no description or other morphological illustrations were provided. According to Tomaszewska and Szawaryn (2016), some parts of genus Epilachna, including E. insignis, have been transferred to the genus Diekeana based on morphological and molecular characters. We collected four adult male specimens from southern part of south Korea and provide a detailed diagnosis for the first time herein. The species of Diekeana insignis can be distinguished by the following morphological characters: pronotum with transverse black marking in middle part, elytra strongly convex with densely pubescence, each elytron with seven large black markings, penis long, slightly bent at apical part, truncate at apex, parameres narrow and as long as penis guide in lateral view, penis guide narrow and pointed at apex.</p> </div>	https://treatment.plazi.org/id/03DB87BDAA6E3E5AFCD0F8D2FC12F89A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Jung, Sang Woo;Kim, Chan Shin and Yoon-Ho	Jung, Sang Woo, Kim, Chan Shin and Yoon-Ho (2023): New report of Diekeana insignis (Gorham, 1892) (Coleoptera: Coccinellidae: Epilachnini) in South Korea. Journal of Species Research 12 (3): 240-243, DOI: 10.12651/JSR.2023.12.3.240
