identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
4A755A9122FA2471CEFBA72ABB06BA1D.text	4A755A9122FA2471CEFBA72ABB06BA1D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Amynthas daeari	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p> Amynthas daeari sp. n.</p>
            <p>Material examined.</p>
            <p>IV0000261261, mature specimen complete but broken in two at clitellum after being figured and dissected. Collected from small valley at Jeollabuk-do, Wanju-gun, Dongsang-myeon, Daea-ri (35.9801N, 127.2981E); collected 27th July, 2012 by Dr Hong-Yul Seo. DNA tissue sample code - w53.</p>
            <p>Etymology.</p>
            <p>Noun from location.</p>
            <p> Diagnosis . </p>
            <p> Amynthas with two pairs of spermathecal pores in 6/7/8 complying with an  Amynthas tokioensis -group; spermathecae with compressed clavate diverticula; GMs median to spermathecal and male pores with patches around the former and the latter bracketed laterally by small C-shaped clefts. </p>
            <p>Distribution.</p>
            <p>Only known from a single specimen from type locality.</p>
            <p>Habitat.</p>
            <p>In litter layer in forest.</p>
            <p>Behaviour. Habitat, pigmentation and gut contents indicate activity in the litter layer.</p>
            <p>Description.</p>
            <p>Length. 150 mm.</p>
            <p>Width. ca. 7 mm at male pore level.</p>
            <p>Segments. 107.</p>
            <p>Colour. Brown in alcohol, possibly darker in life as liquid was stained.</p>
            <p>Prostomium. Open epilobous.</p>
            <p>First dorsal pore. 12/13.</p>
            <p>Setae. Ca. 60 per segment, approximately 22-24 between spermathecal and male pores.</p>
            <p>Nephropores. Not found.</p>
            <p>Clitellum. Annular 14-16, setae occluded.</p>
            <p>Male pores. On 18 centred on small, round porophore (found by following a pin from prostate gland exit) with GMs anterio-median and shallow clefts laterally (that function as seminal ducts and/or suction cups?).</p>
            <p>Female pores. Single on 14.</p>
            <p>Spermathecal pores. 6/7/8 ca 0.3 C apart at edge of puckered area and lateral to GMs.</p>
            <p>Genital markings. Paired discs just median to male and spermathecal pores as noted; composite glands on spermathecal pore GMs but none found for GMs near male pores although the body here is macerated and they may well have broken off and dissipated.</p>
            <p>Septa. Nephridial forests on septa 5 &amp; 6; 7/8 thin, 8/9/10 aborted.</p>
            <p>Dorsal blood vessel (dbv). Single.</p>
            <p>Hearts. Last hearts in 13 (preceding vascularization unclear/damaged).</p>
            <p>Gizzard. Single in 8-9.</p>
            <p>Calciferous glands. Absent.</p>
            <p>Intestine. Indeterminate as specimen macerated; caeca ventrally incised from 27; typhlosole not noted.</p>
            <p>Nephridia. Meroic.</p>
            <p>Male organs. Holandric, seminal vesicles in 11 &amp; 12.</p>
            <p>Ovaries. In 13 as usual.</p>
            <p>Prostates. Racemose glands in 17-19, duct short and muscular.</p>
            <p>Spermathecae. Two pairs in 7 and 8; that in 7lhs inflated, that in 8lhs deflated (showing how meaningless such a distinction is although relied on by some authors).</p>
            <p>Gut contents. Coarse organic debris, i.e., a litter diet suggesting superficial feeding.</p>
            <p>DNA COI barcode.</p>
            <p> &gt;w53  Amynthas daeari Holotype. </p>
            <p> CTATATTTCATTTTAGGAATTTGAGCTGGAATAATTGGGGCAGGAATAAGACTGCTTATTCGAATTGAGCTAAGACAGCCGGGCTCTTTTCTAGGAAGGGATCAACTCTATAATACAATTGTAACA  GCTCATGCATTTTTAATAATCTTCTTTCTTGTAATACCAGTATTTATTGGTGGGTTTGGAAATTGACTTCTACCTCTAATACTAGGTGCCCCAGATATAGCTTTCCCGCGACTTAACAATATAAGATTCTGATTACTGCCCCCATCACTAATTTTACTAGTATCGTCTGCAGCAGTAGAAAAAGGTGCCGGAACAGGATGGACAGTGTACCCCCCACTTGCGAGAAACATTGCACATGCCGGCCCTTCAGTAGATCTTGCAATTTTTTCTCTCCATCTAGCCGGAGCATCATCAATTCTCGGTGCCATCAACTTCATTACTACCGTAATTAATATACGATGATCTGGGCTACGCTTAGAACGAATTCCTCTATTTGTATGAGCAGTTGTAATTACTGTAATTCTTTTACTTCTATCTTTACCAGTCTTAGCCGGTGCTATTACAATATTACTAACAGACCGAAACCTAAATACATCATTTTTTGATCCAGCGGGAGGAGGTGATCCAATTCTATATCAACACTTATTT</p>
            <p> megaBLAST result: "  Amynthas tappensis " (AB542547.1) from Japan max. identity &lt;88% this then is a different and likely new taxon. The closest match from current Korean studies with BLASTn identity 565/653 (87%) is WO49, an immature  Amynthas sp. from Jeju that itself comes closest to the  Amynthas tokioensis /  Metaphire hilgendorfi spp. complexes (see Blakemore 2013a: Appendix). </p>
            <p>Remarks.</p>
            <p> Of  Amynthas species with spermathecae in 6/7/8, twenty or so in the  Amynthas tokioensis -group of Sims and Easton (1972) mostly have manicate caeca, such as  Amynthas kanrazanus (Kobayashi, 1937); about twenty other species, many placed in this group after 1972, have simple intestinal caeca. Only four have simple incised caeca as here, but they all differ in characteristics of their GMs, at least, and none of these latter are known from Korea (Blakemore unpublished). The incised caeca is assumed to be a characteristic transitional or intermediate from simple to complex/manicate. The GMs in 7-8 obviously correspond to those in 18 during amphimixis but it is not known whether they interlock serially. The shape of the spermathecae and spermathecal pores are further distinguishing characteristics of  Amynthas daeari that, along with its objective DNA barcode data, now serve to define this taxon. </p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/4A755A9122FA2471CEFBA72ABB06BA1D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Blakemore, Robert J.;Lee, Seunghan;Lee, Wonchoel;Seo, Hong-Yul	Blakemore, Robert J., Lee, Seunghan, Lee, Wonchoel, Seo, Hong-Yul (2013): Two new Korean earthworms (Annelida, Oligochaeta, Megadrilacea, Megascolecidae). ZooKeys 307: 35-44, DOI: http://dx.doi.org/10.3897/zookeys.307.5362, URL: http://dx.doi.org/10.3897/zookeys.307.5362
C6A6E40C6B3DF0BCEBF6C51DE3C748F1.text	C6A6E40C6B3DF0BCEBF6C51DE3C748F1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Amynthas jinburi	<html xmlns:mods="http://www.loc.gov/mods/v3">
    <body>
        <div>
            <p> Amynthas jinburi sp. n.</p>
            <p>Material examined.</p>
            <p>IV0000213690, sub-mature specimen, figured and dissected. From Gangwon-do, Goseong-gun, Ganseong-eup, Jinbu-ri (ca. 38.2961N, 128.3546E) just north of Seoraksan Park on East coast; collected 1st - 2nd June, 2000 by unknown person(s) and deposited in NIBR. DNA tissue sample w61b (unsuccessful at this time).</p>
            <p>Etymology.</p>
            <p>Noun from location.</p>
            <p>Diagnosis.</p>
            <p> Amynthas with two pairs of spermathecal pores in 5 &amp; 6; long, clavate spermathecal diverticula; simple caeca; and GMs absent except for large patches surrounding male pores. </p>
            <p>Distribution.</p>
            <p>Known only from single specimen from type locality.</p>
            <p> Habitat . </p>
            <p>Jinburi is a remote, mountainous and forested area</p>
            <p>Behaviour. Possibly deep burrowing and geophageous (from gut contents).</p>
            <p>Description.</p>
            <p>Length. 210 mm.</p>
            <p>Width. ca. 10 mm at male pore level.</p>
            <p>Segments. 143 with some secondary annulation (from preservation?).</p>
            <p>Colour. Bleached pale yellow in aged alcohol, possibly darker in life.</p>
            <p>Prostomium. Open epilobous.</p>
            <p>First dorsal pore. 11/12.</p>
            <p>Setae.&gt;100 per segment; e.g. 100+ on 11 and 112 counted on segment 12; approximately 16 setae intervene between male pore pads that are asetal on 18.</p>
            <p>Nephropores. Not found.</p>
            <p>Clitellum. Slightly darker at 14-16.</p>
            <p>Male pores: On 18 on small, rounded and flat porophores.</p>
            <p>Female pores. Single on 14.</p>
            <p>Spermathecal pores. At posterior of 5 and 6 approximately 0.3 C apart.</p>
            <p>Genital markings. None (sub-adult?).</p>
            <p>Septa. Nephridial forests on septa 5 &amp; 6; 5/6/7/8 thick, 8/9 thin to base of gizzard, 9/10 aborted.</p>
            <p>Hearts. Seen in 11-13 (aborted in 10?).</p>
            <p>Gizzard. Single in 8-9.</p>
            <p>Calciferous glands. Absent.</p>
            <p>Intestine. From 15; caeca simple elongate from 27; typhlosole not noted.</p>
            <p>Nephridia. Meroic.</p>
            <p>Male organs. Holandric, testes small in 10 &amp;11; seminal vesicles in 11 &amp; 12.</p>
            <p>Ovaries. Compact in 13; ovisacs not found in 14.</p>
            <p>Prostates: Racemose glands not fully developed in 18 on short, muscular duct.</p>
            <p>Spermathecae. Two pairs in 6 &amp; 7 exiting to anterior of 5/6 and 6/7 in 5 &amp; 6 (Fig. 2).</p>
            <p>Gut contents. Filled with yellow soil, i.e. probably a deep-burrowing subsoil geophage.</p>
            <p>DNA COI barcode.</p>
            <p> &gt;w61  b– nil result, DNA not extractable on this older material that may have been fixed in formalin (although there was no odour) or denatured by pH. </p>
            <p>Remarks.</p>
            <p> Of all 970 pheretimoid species (Blakemore 2008a), only two are known to have spermathecal pores in 5 &amp; 6: viz.  Amynthas serenus (Gates, 1936) from Pahang, Malaysia that also lacks GMs, and  Amynthas? breviclitellatus (Do &amp; Tran, 1995) from Vietnam that differs, at least, in its GMs in 7, 18 and 19. From  “Kôryô” Korea (about 30 Km from Seoul),  Amynthas fibulus fibulus (Kobayashi, 1936: 159) is superficially similar but has spermathecal pores anteriorly in 6 &amp; 7 (rather than posteriorly in 5 &amp; 6) plus its caeca are incised ventrally (rather than smooth); ditto for  Amynthas fibulus ranunculus (Kobayashi, 1936: 162) that further has slits lateral to male pores. Interestingly,  Kobayashi’s (1936: fig. 6) sketch of a prostate gland of  Amynthas fibulus closely resembles the current  specimen’s gland (Fig. 2). </p>
            <p> It should be here noted that Sims and Easton (1972) inadvertently place these two  fibulus taxa in an  Amynthas morrisi -group defined with spermathecae in 5/6/7 despite Kobayashi (1936: 159) stating "  Spermathecal pores , minute, 2 pairs anteriorly located on VI and VII, closely to the intersegmental furrows", i.e. strictly complying with Sims &amp;  Easton’s canaliculatus-group (then comprised of benignus Chen, 1946; canaliculata Gates, 1932; ralla Gates, 1936: 104; and rallida Gates, 1936: 106). It appears that many of Hong and  James’ (2001: 67, 68, 69, 75) taxa have a similar attribute although their descriptions are ambiguously stated, such as: " Spermathecal pores in 5/6 and 6/7...at or near leading edge of vi, vii" and no useful figures are provided for the reader to decide. </p>
            <p> If spermathecal pores were in 5/6/7 in any of the above taxa, then the  morrisi-group’s possible nearest relatives from Korea would likely be  Amynthas koreanus (Kobayashi, 1938: 115) that, however, has manicate caeca; or  Amynthas kobayashii (Kobayashi, 1938: 119) and  Amynthas geojeinsulae (Song &amp; Paik, 1970) that both have male fields from 17-19 but differ in simple or incised caeca, respectively; or  Amynthas assimilis Hong &amp; Kim, 2002 that, like many of its similar cited taxa, has seminal grooves on 18. </p>
            <p>The current species has simple, superficial male pores on large disc-like pads on 18. Although not fully mature, it appears unique in the Korea fauna on its combination of this aspect of its male field, spermathecal pores in 5 &amp; 6 and its profusion of setae that number more than 100 per segment, combined with simple elongate intestinal caeca.</p>
            <p>Fresh topotypic material is required to confirm these conclusions and to provide definitive DNA data, unless refinement of techniques allows extraction from older types.</p>
        </div>
    </body>
</html>
	https://treatment.plazi.org/id/C6A6E40C6B3DF0BCEBF6C51DE3C748F1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Blakemore, Robert J.;Lee, Seunghan;Lee, Wonchoel;Seo, Hong-Yul	Blakemore, Robert J., Lee, Seunghan, Lee, Wonchoel, Seo, Hong-Yul (2013): Two new Korean earthworms (Annelida, Oligochaeta, Megadrilacea, Megascolecidae). ZooKeys 307: 35-44, DOI: http://dx.doi.org/10.3897/zookeys.307.5362, URL: http://dx.doi.org/10.3897/zookeys.307.5362
