taxonID	type	description	language	source
03BF8783FF8BFFC6FF23F98D9F08FB3E.taxon	description	(Fig. 1 part, 7 – 8)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF8BFFC6FF23F98D9F08FB3E.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that a specimen from Peru (Fig. 1 orange) is genetically differentiated from its sister Emesis (Emesis) orichalceus Stichel, 1916 (type locality in Bolivia, syntype sequenced as NVG- 18043 E 06) (Fig. 1 olive-colored clade) at the species level, e. g., their COI barcodes differ by 2.1 % (14 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to E. orichalceus and Emesis neemias Hewitson, 1872 (type locality in Brazil) and differs from its relatives by postdiscal and submarginal bands of metallic crescents on hindwing being farther from each other, less orange-red and more purplish ventral side of wings with more prominent pale ray near the anal margin of hindwing, and typically larger and more diffuse tornal dark spots on ventral side of both wings. In addition to the holotype of the new species (Fig. 7 – 8), we also illustrate a typical male of E. orichalceus (NVG- 18045 D 03, USNMENT 01466452 Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, 800 m, GPS − 15.8056, − 67.4908, Brian Harris leg. [USNM]) (Fig. 9 – 10). Due to unexplored phenotypic variation in the new species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 1775.9.1: T 306 C, cne 1775.9.1: A 795 G, cne 403.3.3: A 120 G, cne 403.3.3: T 135 C, cne 4207.3.2: C 32 G, cne 253.1.13: G 171 G (not A), cne 10789.3.8: A 150 A (not G), cne 2851.12.1: C 104 C (not A), cne 2851.12.1: A 123 A (not G), cne 13070.7.1: G 1255 G (not A), and COI barcode: T 34 A, A 130 T, T 133 C, 169 C, T 484 T. Barcode sequence of the holotype. Sample NVG- 18052 F 04, GenBank PQ 203545, 658 base pairs: AACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GCTCATTAATTGGAGATGACCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATT ATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATACTTGGAGCACCAGATATAGCATTTCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCTTCTTTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATTGCTCATGGAGGATCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATT TTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCATTATTTGTTTGAT CAGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACACTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF8BFFC6FF23F98D9F08FB3E.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 7 – 8, bears the following four rectangular labels (1 st green, last red, others white; 2 nd handwritten, others printed): [Mt. Alegre, Rio | Pachitea O. Peru | G. Tessmann], [DNA sample ID: | NVG- 18052 F 04 | c / o Nick V. Grishin], [neemias Hew.], and [HOLOTYPE ♂ | Emesis (Emesis) | aerunda Grishin]. Type locality. Peru: Rio Pachitea, Monte Alegre. This is also the type locality of Pseudophaloe tessmanni Hering, 1925 (Erebidae: Arctiinae), Hylesia natex Draudt, 1929 (Saturniidae), and Synargis flavicauda Grishin, 2023 (Riodinidae), among others.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF8BFFC6FF23F98D9F08FB3E.taxon	etymology	Etymology. In Latin, aeruginosus means brassy or verdigris-colored, and unda means wave. The name is given for the metallic green wavy pattern of this species: aeru [ginosus] + [u] nda and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF8BFFC6FF23F98D9F08FB3E.taxon	distribution	Distribution. Currently known only from the holotype collected in central Peru.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	description	(Fig. 1 part, 13 – 14)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that a specimen from Guyana (Fig. 1 aquamarine) is genetically differentiated from its sister Emesis (Emesis) aerigera (Stichel, 1910) (type locality in Brazil: Sao Paulo, syntype sequenced as NVG- 18054 D 07) (Fig. 1 brown) at the species level, e. g., their COI barcodes differ by 4.0 % (26 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to E. aerigera and differs from it by narrower metallic bands with less interconnected and aligned spots, a metallic postdiscal spot in the forewing cell M 1 - M 2 being stronger offset basad from the band, and forewings with slightly less hooked apex. In addition to the holotype of the new species (Fig. 13 – 14), we also illustrate a syntype, a male, of E. aerigera (NVG- 18054 D 07 Brazil: Sao Paulo, Casa Branca, 1890, Garbe leg. [MFNB]) (Fig. 11 – 12). Furthermore, see iNaturalist observation 160938035 of E. aerigera female from Brazil: Santa Catarina for comparison (iNaturalist 2024). Due to unexplored phenotypic variation in this species and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2800.4.2: T 142 A, cne 6221.18.5: T 129 C, cne 6221.18.5: A 144 G, cne 15953.4.2: T 15 A, cne 15953.4.2: A 51 G, cne 2337.3.4: A 45 A (not T), cne 2337.3.4: T 48 T (not C), cne 7747.1.14: C 116 C (not G), cne 7747.1.14: C 120 C (not G), cne 4614.6.1: C 264 C (not T), and COI barcode: T 49 T, T 103 C, A 238 A, T 373 C, T 442 C, T 553 C. Barcode sequence of the holotype. Sample NVG- 18048 H 03, GenBank PQ 203546, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGTACATCTTTAAGTTTATTAATTCGTATAGAATTAGGAACTTCTG	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	description	ATAATTGGAGGATTTGGTAATTGGTTAGTTCCTCTTATATTAGGAGCCCCTGATATAGCATTCCCACGTATAAATAATATAAGAT TTTGATTATTACCCCCATCCTTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCTCATGGAGGCTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATT TTAGGAGCAATTAACTTTATTACAACTATTATTAATATACGAATTAATAATATATCTTTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACTGCTCTTTTATTATTACTATCTCTTCCCGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCAGCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 13 – 14, bears the following four printed rectangular labels, three white: [Bartica | Bartica District | British Guiana], [DNA sample ID: | NVG- 18048 H 03 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01466572], and one red [HOLOTYPE ♀ | Emesis (Emesis) | bartica Grishin]. The holotype lacks its abdomen. Type locality. Guyana: Cuyuni-Mazaruni Region, Bartica.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	etymology	Etymology. The name is given for the type locality and is a feminine noun in apposition. Furthermore, the name Bartica comes from an Amerindian word, possibly Arawakan or Cariban, that means “ red earth, ” and seems suitable for this reddish-colored species.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF84FFC7FF23FB0B9A72FBCC.taxon	distribution	Distribution. Currently known only from the holotype collected in Guyana. Emesis (Emesis) nobilata Stichel, 1910 is a species distinct from Emesis (Emesis) fatimella Westwood, 1851 Genomic analysis reveals that Emesis fatima nobilata Stichel, 1910 (type locality in Costa Rica, syntype sequenced as NVG- 18052 D 01) currently regarded as a subspecies of Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) (Callaghan and Lamas 2004) is genetically differentiated from it at the species level (Fig. 1), e. g., their COI barcodes differ by 2.9 % (19 bp). In the presence of recognizable phenotypic differences — males of E. fatimella nobilata have darker ground color and larger, more diffuse spotting compared to the nominate subspecies — we propose to treat Emesis (Emesis) nobilata Stichel, 1910, new status, as a species-level taxon.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	description	(Fig. 1 part, 15 – 16, 81 – 82)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Emesis [Fabricius], 1807 reveals that two specimens from Southeast Brazil and South Brazil (Fig. 1 red) form a clade sister to both Emesis (Emesis) nobilata Stichel, 1910, new status (type locality in Costa Rica) and Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) and are genetically differentiated from their relatives (Fig. 1 cyan, blue, and magenta) at the species level, e. g., their COI barcodes differ by 4.1 % – 4.6 % (27 – 30 bp). Therefore, these specimens represent a new species. This new species is phenotypically similar to E. nobilata and E. fatimella and differs from its relatives by the ground color that is paler and more orange than in E. nobilata, but yellower (rather than orange) beneath compared even to E. fatimella, sharper defined and less diffuse dark markings on the dorsal side, and generally smaller submarginal brown spots on the ventral side; these spots are not all the same size and the size difference among them appears more pronounced than in other species. In male genitalia (Fig. 81 – 82), the lower valval projection is not developed, the upper projection is claw-like with the inner broad tooth, aedeagus terminally with several stronger sclerotized broad teeth around the posterior margin. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 11524.2.14: G 153 A, cne 877.3.6: T 267 C, cne 764.2.12: C 144 T, cne 764.2.12: C 154 A, cne 6813.1.17: G 103 T, and COI barcode: A 1 T, T 169 A, T 232 C, A 433 T, T 526 C, T 646 C. Barcode sequence of the holotype. Sample NVG- 18044 H 01, GenBank PQ 203547, 658 base pairs: TACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATCTTTAATTGGCGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGCGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCCTTCCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCATCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	description	CCCACTTTCATCTAATATTGCTCATGGTGGATCTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATT TTAGGTGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAT CAGTAGGAATTACCGCTCTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 15 – 16, bears the following six printed (text in italics handwritten) rectangular labels, five white: [Brasil: Santa Catarina | Joinville: 10 - 200 m | 26 Feb 1991 | Leg. H. Miers], [DNA sample ID: | NVG- 18044 H 01 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 04 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 09 | Nick V. Grishin], [USNMENT | {QR Code} | 01466402], and one red [HOLOTYPE ♂ | Emesis (Emesis) | fatimellina Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1 ♂: NVG- 18052 G 08 Brazil: Rio de Janeiro, Teresópolis, coll. H. Stichel number 3305 [MFNB]. Type locality. Brazil: Santa Catarina, Joinville.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	etymology	Etymology. The name is formed from the name of its South American relative, E. fatimella, which is made longer for this more southern species and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF85FFC4FF23FB5999D8FC9A.taxon	distribution	Distribution. Southeast and South Brazil.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF86FFC5FF23FCE99F3DFDB4.taxon	description	(Fig. 1 X part, 17 – 18, 83 – 84)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF86FFC5FF23FCE99F3DFDB4.taxon	diagnosis	Definition and diagnosis. A more detailed comparison of Emesis (Emesis) fatimella Westwood, 1851 (type locality in Suriname and Brazil: Amazonas) relatives reveals that in addition to the most genetically divergent species, Emesis (Emesis) fatimellina, new species, a specimen from Panama (Fig. 1 magenta) is not tightly clustered with either Emesis (Emesis) nobilata Stichel, 1910, new status (type locality in Costa Rica) (Fig. 1 cyan) or E. fatimella (Fig. 1 blue) and instead is genetically differentiated from them at the species level, e. g., their COI barcodes differ by 2.4 % (16 bp) from E. nobilata and by 3.2 % (21 bp) from E. fatimella. Therefore, this specimen represents a new species. This new species is phenotypically similar to E. nobilata and E. fatimella and differs from them by the color of both sides of wings being brighter orange than in E. nobilata, and by more deep orange (rather than yellower) colors compared to E. fatimella, approximately the same color of dorsal and ventral side of wings (ventral is typically yellower than dorsal in E. fatimella), and usually sharper defined and less diffuse submarginal spots on forewing, and whiter scales on thorax, basal half of legs and abdomen beneath. In male genitalia (Fig. 83 – 84), the lower valval projection is much smaller, directed inward, the upper projection is strongly elongated, longer than falces, claw-like with the inner broad tooth, aedeagus is narrower and longer. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2539.10.4: T 57 C, cne 33461.1.2: A 87 G, cne 7180.6.10: A 120 G, cne 7180.6.10: T 174 A, cne 65262.1.1: A 648 G, cne 254622.4.2: G 30 G (not A), cne 254622.4.2: A 42 A (not G), cne 3597.4.3: A 73 A (not G), cne 3597.4.3: C 74 C (not A), cne 3597.4.3: C 85 C (not T), and COI barcode: A 85 A, T 361 C, A 379 C, T 533 C, A 604 C. Barcode sequence of the holotype. Sample NVG- 18044 G 07, GenBank PQ 203548, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGTGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGAT TTTGATTATTACCTCCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATCGCTCATGGCGGATCTTCCGTAGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCTTCTATT TTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTATGAT CTGTAGGAATTACTGCTCTTCTATTATTATTATCTCTACCCGTATTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACCTCATTCTTTGATCCAGCTGGTGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF86FFC5FF23FCE99F3DFDB4.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 17 – 18, bears the following six printed (text in italics handwritten) rectangular labels, five white: [PANAMA: DARIEN | Cana (Cerro Pirre) | 1000 m | 7 ° 56 ’ N 77 ° 43 ’ W | 31 I 1984 | leg. G. B. Small], [DNA sample ID: | NVG- 18044 G 07 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 05 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 10 | Nick V. Grishin], [USNMENT | {QR Code} | 01466396], and one red [HOLOTYPE ♂ | Emesis (Emesis) | panamella Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Panama: Darién Province, Cana, Cerro Pirre, elevation 1000 m, approx. GPS 7.933 3, − 77.7167.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF86FFC5FF23FCE99F3DFDB4.taxon	etymology	Etymology. The name is a fusion of the type locality country name with the name of a relative from South America: Pana [ma [+ [fati] mella. The name is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF86FFC5FF23FCE99F3DFDB4.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	description	(Fig. 2 part, 19 – 22, 85 – 88)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	diagnosis	Definition and diagnosis. As discussed above, Emesis russula Stichel, 1910 (type locality in Boliv ia: La Paz, Farinas) populations partition into two subclades that we define as subspecies (Fig. 2 green and brown). Their COI barcodes differ by 1.2 % (8 bp). The lectotype designation assigns the nominate subspecies to the northwestern populations of E. russula from the Andes, and the southeastern subspecies is new. This new subspecies differs from the nominotypical subspecies by more developed and darker pattern elements on the wings’ dorsal side that is somewhat redder in color, usually without purplish gloss, and the ventral side is typically with heavier reddish markings. Due to unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 5853.5.7: C 70 T, cne 12666.1.11: T 552 C, cne 2259.5.9: A 147 C, cne 6241.3.5: G 24 A, cne 4342.8.1: A 349 T. However, the COI barcode may not differentiate between subspecies due to introgression. We hypothesize this because, in the specimens we sequenced, the barcode of the new subspecies is more similar to Emesis (Mandania) mandana (Cramer, 1780) (type locality in Suriname) than to its closer relative E. russula russula (Fig. 2 c brown to blue rather than brown to green). Therefore, these barcodes likely represent a later introgression event rather than the original barcodes of the new subspecies. It remains unclear if the introgression is complete, and these E. mandana - like barcodes are present in all specimens of the new subspecies (less likely), or if the original, E. russula - like barcodes are still present in some individuals of the new subspecies (more likely). In our current dataset, the two subspecies differ in their COI barcodes, and the COI barcode corresponding to the new subspecies is diagnosed by a combination of the following base pairs A 34 A, T 136 T, C 220 C, T 397 T, A 412 G, C 421 C. However, if some specimens of the new subspecies possess barcodes similar to those of the nominate subspecies, they may not be identifiable by barcodes. Barcode sequence of the holotype. Sample NVG- 18044 D 12, GenBank PQ 203550, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCGGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	materials_examined	Type material. Holotype: ♀ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 19 – 20, bears the following six rectangular labels (3 rd blue, the last red, and others white; 2 nd handwritten, others printed with handwritten text marked in italics): [BRAZIL: PR | 30 km NW Ponta | Grossa, 900 m | 24 O 57 ’ S 50 O 28 ’ W | 19 Mar 1991 | Robbins, Mielke & | Cassagrande, leg.], [russula], [JHALL | - 00 02], [DNA sample ID: | NVG- 18044 D 12 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01466367], and [HOLOTYPE ♀ | Emesis (Mandania) russula | sudesta Grishin]. Paratypes: 4 ♂♂ and 3 ♀♀: Paraguay [USNM]: 1 ♂ NVG- 18045 H 11 (leg), NVG- 23114 G 06 (abdomen), USNMENT 01466507, genitalia vial NVG 240817 - 11 (Fig. 21 – 22, 85 – 86) and 1 ♀ NVG- 18044 F 07 (leg), NVG- 23114 G 07 (abdomen), USNMENT 01466386 from Sapucaí, old (around 1900), W. T. Foster leg., genitalia vial NVG 240817 - 12 (Fig. 87 – 88) and 1 ♂ NVG- 18044 E 10, USNMENT 01466377 Paraguarí Department, 25 km SE of Ybycui, Ybycui National Park, 12 - 24 - Apr- 1980, P. J. Spangler et al.; Brazil, Paraná [USNM]: 1 ♂ NVG- 18045 H 10, USNMENT 01466506 Castro, old, W. Schaus collection [USNM] and 1 ♀ NVG- 18045 A 07, USNMENT 01466420 the same data as the holotype; 1 ♀ NVG- 18052 C 12, paralectotype of E. russula, Brazil, “ S. Leopoldina ” or “ S. Leopoldo ” [MFNB]; and 1 ♂ NVG- 18039 G 06 Argentina: Buenos Aires, old, Strecker collection, No. 9477 [FMNH]. Type locality. Brazil: Paraná, 30 km northwest of Ponta Grossa, elevation 900 m, GPS − 24.950, − 50.467.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	etymology	Etymology. The name russula possibly originated from the Latin word russus, which means reddish, although the color of this species is less red than that of E. mandana. In Portuguese, sudeste means southeast, and the name is given for the southeastern distribution of this subspecies compared to the nominate. The name is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	distribution	Distribution. Recorded from southern Brazil (e. g., Paraná), Paraguay, and northeastern Argentina.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF87FFC3FF21F9369A4BF9B9.taxon	discussion	Comment. We conservatively propose this new taxon as a subspecies due to its small genetic differentiation, especially in the Z chromosome (Fig. 2 b), and limited phenotypic distinction. To aid future comparisons, we illustrate the genitalia of the nominate E. russula male NVG- 18044 D 11 (leg), NVG- 23114 G 08 (abdomen), USNMENT 01466366 from Bolivia: La Paz, Chulumani, 600 m, GPS- 16.400, - 67.517, 27 - May- 1989, C. Covell leg., genitalia vial NVG 240817 - 13 [USNM] (Fig. 89 – 90), which may have less robust valvae with narrower upper and lower projections. We note that considering generally small genetic differences among species of Emesis (Mandania), it is possible that future research may demonstrate that the new subspecies described here is a species-level taxon.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF82FFC0FF23FDA59F57F8E8.taxon	description	(Fig. 2 part, 23 – 24, 91 – 92)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF82FFC0FF23FDA59F57F8E8.taxon	diagnosis	Definition and diagnosis. As discussed above, a genetically and phenotypically distinct specimen from Ecuador (Fig. 2 orange) represents a new species of the subgenus Mandania Grishin, 2019. This new species is phenotypically similar to other Mandania and differs from its closest relatives by being paler and less saturated in color (i. e., plainer, less red, grayer) than E. mandana, but with a more contrasting pattern of dark spots and bands than E. furor, and broader wings than E. russula. The holotype is also notably larger than a typical Mandania (Fig. 19 – 26), and the size may be one of the characters for the new species. However, the size is typically variable, and without a series of specimens, it is not possible to ascertain. In female genitalia (Fig. 91 – 92), ductus bursae with a loop near a spherical corpus bursae, two very large (about ½ of the corpus diameter) horn-like signa at the caudal end of corpus, signum is more curved and with a larger base compared to its length, sternite VII (“ genital plate ”) with posterior margin shaped as a broad V less rounded on the sides and in the middle. Due to unexplored phenotypic variation and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 1684.6.12: G 143 A, cne 3364.6.1: A 299 G, cne 2551.8.1: A 315 G, cne 2551.8.1: C 327 T, cne 350.7.4: T 726 C, cne 399.1.1: T 225 T (not G), cne 2564.2.1: A 56 A (not T), cne 6857.5.3: A 318 A (not G), cne 6857.5.3: T 375 T (not A), cne 1186.1.1: A 119 A (not T), and COI barcode: C 50 C, T 106 T, T 235 T, A 412 A, T 581 T, T 595 C. Barcode sequence of the holotype. Sample NVG- 18045 H 12, GenBank PQ 203551, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAACTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF82FFC0FF23FDA59F57F8E8.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 23 – 24, bears the following six printed rectangular labels, five white: [Riodinidae V- 31 - 1978 | Emesis fatima M | SDLC, Ecuador, 1800 ft], [DNA sample ID: | NVG- 18045 H 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 09 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 14 | Nick V. Grishin], [USNMENT | {QR Code} | 00940170], and one red [HOLOTYPE ♀ | Emesis (Mandania) | mandora Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Ecuador: Santo Domingo de los Colorados, elevation 550 m.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF82FFC0FF23FDA59F57F8E8.taxon	etymology	Etymology. The name is a modified fusion of the name of a related species with the name of the country with the type locality: mand [an] + [Ecua] dor + a. The name is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF82FFC0FF23FDA59F57F8E8.taxon	distribution	Distribution. Currently known only from the holotype collected in Ecuador.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF83FFC1FF23FF3A9955F92C.taxon	description	(Fig. 2 part, 25 – 26, 93 – 94)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF83FFC1FF23FF3A9955F92C.taxon	diagnosis	Definition and diagnosis. As discussed above, a genetically and phenotypically distinct specimen from Peru (Fig. 2 magenta) represents a new species of the subgenus Mandania Grishin, 2019. This new species is phenotypically similar to other Mandania and differs from its closest relatives by being darker, dorsally more maroon than orange, orange-red, or brown; in particular, the difference in darkness is more obvious towards the apex and costal margin of the dorsal hindwing and on the ventral side, towards the margins. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 216.12.3: T 242 C, cne 216.12.3: T 414 A, cne 216.12.3: A 426 T, cne 9580.1.6: T 99 G, cne 9580.1.6: G 111 T, cne 5285.1.8: C 60 C (not T), cne 5285.1.8: C 81 C (not T), cne 5285.1.8: G 114 G (not A), cne 6560.2.3: A 489 A (not T), cne 6560.2.3: T 504 T (not C), and COI barcode: C 50 C, T 106 T, T 235 T, A 388 G, A 412 A, T 581 C, T 595 T. Barcode sequence of the holotype. Sample NVG- 18044 D 07, GenBank PQ 203552, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGATTATTAATTCGAATAGAATTAGGAACTTCAG GATCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGAT TTTGACTTTTACCTCCATCTTTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCTCATGGAGGTTCTTCAGTAGATTTGGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATT TTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTTTGAT CTGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTT AAATACATCATTCTTTGATCCTGCTGGTGGTGGTGATCCTATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF83FFC1FF23FF3A9955F92C.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 25 – 26, bears the following six printed (text in italics handwritten) rectangular labels, five white: [PERU: Cuzco, 1050 m | Quitacalzón | Cosnipata Valley 4856 | 01 - XI- 2016 Kinyon], [DNA sample ID: | NVG- 18044 D 07 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 10 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 15 | Nick V. Grishin], [USNMENT | {QR Code} | 01466363], and one red [HOLOTYPE ♂ | Emesis (Mandania) | manduza Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Peru: Cuzco Department, Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m, GPS − 13.0167, − 71.4833.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF83FFC1FF23FF3A9955F92C.taxon	etymology	Etymology. The name is a modified fusion of the name of a related species with the name of the Peruvian region with the type locality: mand [an] + [c] uz [co] + a. The name is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF83FFC1FF23FF3A9955F92C.taxon	distribution	Distribution. Currently known only from the holotype collected in southern Peru. Emesis (Tenedia) tristis Stichel, 1929 is a species distinct from Emesis (Tenedia) lupina Godman and Salvin, 1886 Genomic analysis reveals that Emesis tristis Stichel, 1929 (type locality in Mexico: Colima, syntype sequenced as NVG- 18043 E 08) currently regarded as a junior subjective synonym of Emesis (Tenedia) lupina Godman and Salvin, 1886 (type locality in Costa Rica) (Zhang et al. 2019 b), while being closely related to it, is genetically differentiated from it at the species level (Fig. 3), e. g., their COI barcodes differ by 2.3 % (15 bp). In the presence of recognizable phenotypic differences — E. tristis of both sexes being darker in ground color, with less contrasting spots and bands compared to E. lupina — we propose to treat Emesis (Tenedia) tristis Stichel, 1929, reinstated status, as a species-level taxon.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9DFFDCFF23FC689F38FD3A.taxon	description	(Fig. 3 part, 27 – 28, 95 – 96)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9DFFDCFF23FC689F38FD3A.taxon	diagnosis	Definition and diagnosis. Genomic analysis of a female Emesis specimen from Panama with angular wings and a very prominent pale postdiscal half-band on the forewing (Fig. 27 – 28) reveals that it is genetically unique and differentiated from all others we sequenced at the species level (Fig. 3), e. g., its COI barcode differs from the closest species Emesis (Tenedia) tenedia C. Felder and R. Felder, 1861 by 2.7 % (18 bp). Therefore, it represents a new species. This new species is closest to E. tenedia in females having a sharply defined cream-yellow postdiscal band in the anterior half of the forewing, but this band is deeper yellow and with the spot in the cell M 3 - CuA 1 about half of the width of the spot in the cell M 2 - M 3 (usually wider in E. tenedia) and differs in generally more angular wings with a stronger hooked forewing apex. In other species, the outer margin of the forewing is less wavy, with reduced concavity near the apex and in the cell CuA 1 - CuA 2. In female genitalia (Fig. 95 – 96), ductus bursae is not looped, two small (less than ⅛ of the corpus diameter) horn-like signa at the caudal end of the spherical corpus bursae, sternite VII (“ genital plate ”) is trapezoidal, weakly sclerotized especially at the margins, with a straight posterior margin. Due to unexplored phenotypic variation and males still unknown, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 7345.5.3: T 40 C, cne 7345.5.3: A 42 T, cne 3225.1.1: T 168 C, cne 285.13.6: A 126 T, cne 13338.1.2: A 216 T, cne 26870.1.5: G 63 G (not A), cne 26870.1.5: C 64 C (not A), cne 1953.11.4: A 45 A (not G), cne 1953.11.4: T 57 T (not G), cne 5876.11.2: T 321 T (not C), and COI barcode: T 92 C, T 121 C, A 238 G, A 334 G, T 475 C, T 523 C. Barcode sequence of the holotype. Sample NVG- 18044 H 02, GenBank PQ 203553, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTCTATTAATTCGAATAGAATTAGGAACTTCAG GATTTCTAATTGGTGATGATCAAATTTATAATACCATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCGCGAATAAATAACATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACGGTGTACCC CCCACTTTCATCTAATATTGCCCATAGAGGCTCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATC TTAGGAGCAATTAATTTTATCACTACTATTATTAATATACGTATTAACAATTTATCATTTGATCAAATACCCTTATTTATTTGAT CAGTAGGTATCACAGCACTTTTACTTTTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGACCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9DFFDCFF23FC689F38FD3A.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 27 – 28, bears the following six printed (text in italics handwritten) rectangular labels, five white: [PANAMA: CHIRIQUI | Cerro Colorado 1450 m | 8 ° 32 ’ N 81 ° 47 ’ W | 9. VIII. 1979 | leg. G. B. Small], [DNA sample ID: | NVG- 18044 H 02 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 11 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 16 | Nick V. Grishin], [USNMENT | {QR Code} | 01532799], and one red [HOLOTYPE ♀ | Emesis (Tenedia) | nimia Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Panama: Chiriquí Province, Cerro Colorado, elevation 1450 m., approx. GPS 8.533, − 81.783.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9DFFDCFF23FC689F38FD3A.taxon	etymology	Etymology. In Latin, nimius means excessive, extreme, or exaggerated and is given for the extreme looks of this species, both in its more angular wing shape and contrasty yellow patch cut through by dark veins. The name is a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9DFFDCFF23FC689F38FD3A.taxon	distribution	Distribution. Currently known only from the holotype collected in western Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9EFFDDFF23FD089958FEDA.taxon	description	(Fig. 3 part, 29 – 32, 97 – 98)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9EFFDDFF23FD089958FEDA.taxon	diagnosis	Definition and diagnosis. Genomic analysis of two Emesis (Tenedia Grishin, 2019) (type species Emesis tenedia C. Felder and R. Felder, 1861) specimens from Mexico (Fig. 3 aquamarine) reveals that they form a clade sister to both Emesis (Tenedia) lupina Godman and Salvin, 1886 (type locality in Costa Rica) (Fig. 3 cyan) and Emesis (Tenedia) tristis Stichel, 1929, reinstated status (type locality in Mexico: Colima, syntype sequenced as NVG- 18043 E 08) (Fig. 3 gray) and genetically differentiated from them at the species level, e. g., their COI barcodes differ by 4.6 % (30 bp) from E. lupina and 5.2 % (34 bp) from E. tristis. Therefore, these specimens represent a new species. This new species is similar in appearance to E. tristis and E. tenedia in its darker brown dorsal colors of males and more uniformly orange-brown ventral side with darker spots and streaks, but differs from them by slightly narrower wings than in E. tristis, straighter forewing costa and less hooked apex than in E. tenedia, better defined darker bands on dorsal forewing bordered by sharper dark-brown lines composed of curved streaks and dashes, and by brighter orange color of ventral side of wings. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 3200.4.3: A 136 T, cne 13412.2.4: G 67 A, cne 6684.2.15: C 105 T, cne 9580.1.12: A 234 C, cne 3815.7.4: A 169 C, and COI barcode: T 50 C, T 56 C, C 271 T, T 463 C, A 541 G, T 571 C. Barcode sequence of the holotype. Sample NVG- 18044 H 12, GenBank PQ 203554, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTCTAAGTCTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGTTTTGGTAACTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCTCCCTCATTAATCTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATCGCTCATGGAGGATCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAATAATTTATCATTTGATCAAATACCTCTTTTCATTTGAT CAGTAGGTATCACAGCACTTTTACTTTTGCTATCTTTACCTGTTTTAGCTGGAGCTATCACTATACTATTAACAGATCGTAATCT AAATACATCATTTTTTGATCCTGCAGGAGGAGGAGACCCAATTTTATATCAACACTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9EFFDDFF23FD089958FEDA.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 29 – 30, bears the following six printed (text in italics handwritten) rectangular labels, five white: [Tamps, Mexico | Gomez Farias | leg. E. C. Knudson | 12 - X- 1976], [DNA sample ID: | NVG- 18044 H 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 G 12 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 17 | Nick V. Grishin], [USNMENT | {QR Code} | 01466413], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | faria Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1 ♂ NVG- 18044 H 03, USNMENT 01466404 Mexico: Hidalgo, Cuesta Colorada, 21 - Jul- 1981, W. H. Howe leg. [USNM] (Fig. 31 – 32). Type locality. Mexico: Tamaulipas, Gomez Farías.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9EFFDDFF23FD089958FEDA.taxon	etymology	Etymology. The name is formed from the name of the type locality: [Gomez] Faria [s], and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9EFFDDFF23FD089958FEDA.taxon	distribution	Distribution. Eastern Mexico.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDDFF23FEA89F82F981.taxon	description	(Fig. 3 part, 33 – 36, 99 – 102)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDDFF23FEA89F82F981.taxon	diagnosis	Definition and diagnosis. Genomic analysis of a pair of Emesis (Tenedia Grishin, 2019) specimens from Nuevo Leon, Mexico (Fig. 3 magenta) reveals that they form a clade sister to E. tenedia (Fig. 3 olive) and are genetically differentiated from it at the species level, e. g., their COI barcodes differ by 2.0 % (13 bp). Therefore, these two specimens represent a new species. This new species is phenotypically similar to E. tenedia and differs from it by males with typically less elongated and weaker hooked at the apex forewings, more uniform ground color with weaker defined postdiscal paler bands, and weaker expressed gray overscaling along the postdiscal dark narrow band; and by females with less developed pale postdiscal band on the forewing, which is frequently prominent in its anterior half in E. tenedia. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 603.4.1: A 54 G, cne 9180.2.1: A 57 T, cne 1600.2.7: T 120 G, cne 498.4.1: C 141 T, cne 498.4.1: T 183 C, and COI barcode: T 92 C, T 115 C, T 266 C, T 427 C, T 448 C. Barcode sequence of the holotype. Sample NVG- 10597, GenBank PQ 203555, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GATTTCTAATTGGTGATGATCAAATTTACAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGTGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTACTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCTCATAGAGGCTCATCAGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATC TTAGGAGCAATTAATTTTATCACTACTATTATTAATATACGTATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAT CAGTAGGTATTACAGCACTATTACTTTTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDDFF23FEA89F82F981.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Texas A & M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 33 – 34, bears the following six printed (text in italics handwritten) rectangular labels, five white: [MEXICO: | NUEVO LEON | Cola de Caballo | (horsetail falls)], [coll. 24 - X- 1979 | Roy O. Kendall | & C. A. Kendall], [RIODINIDAE: | Emesis tenedia | C. & R. Felder, 1861 | det. Roy O. Kendall | ♂ M. & B. no. 543.1], [DNA sample ID: | NVG- 10597 | c / o Nick V. Grishin], [genitalia | NVG 180106 - 14 | Nick V. Grishin], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | leona Grishin]. Paratype: 1 ♀ NVG- 10598 Mexico: Nuevo Leon, 25 km WSW of Linares, 12 - Nov- 1980, R. O. Kendall and C. A. Kendall leg., genitalia NVG 180106 - 15 [TAMU] (Fig. 35 – 36, 101 – 102). Type locality. Mexico: Nuevo León, Cola de Caballo.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDDFF23FEA89F82F981.taxon	etymology	Etymology. The name is formed from the name of the state with the type locality and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDDFF23FEA89F82F981.taxon	distribution	Distribution. Currently known only from the Sierra Madre Oriental in Nuevo Leon, Mexico.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDAFF23F9E59929F8EC.taxon	description	(Fig. 3 part, 37 – 42, 103 – 104)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDAFF23F9E59929F8EC.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Emesis (Tenedia) angularis Hewitson, 1870 (type locality in Ecuador, a syntype sequenced as NVG- 18038 H 07) reveals that specimens initially identified as this species and collected to the south of Ecuador are genetically differentiated from the true E. angularis at the species level in the nuclear genome (Fig. 3) and their COI barcodes are 1.2 % (8 bp) different. While the COI barcode difference is not very prominent, the nuclear genomes of the two species differ, and the difference correlates with the wing shape in both sexes. Therefore, we hypothesize that the nuclear genome clade (Fig. 3 green), sister to E. angularis (Fig. 3 brown), represents a new species. This new species is similar to E. angularis and differs from it by generally less angular hindwing in males, with less developed protrusion in the middle of the outer margin of the hindwing, with less concave margin anteriad and posteriad of it and usually less contrasting submarginal spot in central hindwing cell RS-M 1. The female of the new species possesses a more obtuse hindwing angle at the outer margin but a more prominently hooked forewing apex with a more concave costal margin in the middle and the outer margin by the apex (i. e., more prominently hooked forewing apex). To illustrate the wing shape difference, we show the hindwing or its part for all three males in the type series (Fig. 37, 41, 42) and two males of E. angularis from Ecuador in USNM: NVG- 18045 B 07, USNMENT 01466432 Morona-Santiago, Nueve de Octubre, 1800 m, − 2.2167, − 78.2167, 10 - Sep- 1999, R. Robbins, R. Busby, G. Estevez, and A. Aldas leg. (Fig. 43) and NVG- 23115 A 11 Pichincha, Baeza, 2000 m, 28 - Sep- 1975, S. S. Nicolay leg. (Fig. 44, 105 – 106). In male genitalia (Fig. 103 – 104), the lower and upper valval projections are more parallel to each other, at a smaller angle than in E. angularis (Fig. 105 – 106), and uncus is convex in the middle, without a small notch. Due to relatively unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 475.6.4: T 21 C, cne 475.6.4: C 57 A, cne 6005.2.1: C 180 T, cne 3598.3.3: A 107 T, cne 7168.1.1: C 410 G, and COI barcode: A 40 G, A 88 G, C 361 C, T 421 C, T 646 C. Barcode sequence of the holotype. Sample NVG- 18045 B 09, GenBank PQ 203556, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GGTCTTTAATCGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATCGCCCATGGAGGATCATCAGTAGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATCTCCTCTATT TTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAACAATTTATCATTTGATCAAATACCTCTTTTTATTTGAT CAGTAGGTATTACAGCACTTTTACTTTTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGTAATTT AAACACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDAFF23F9E59929F8EC.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 37 – 38, bears the following eight rectangular labels (first three handwritten, others printed), seven white: [ARGENTINA | Salta, 750 m. | Agua Blanca rd. | to Angosta, km. 30 – 31], [17. VI. 1977 | R. C. Eisele], [Emesis | angularis ♂ | det. Eisele], [DNA sample ID: | NVG- 18045 B 09 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 01 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 18 | Nick V. Grishin], [USNMENT | {QR Code} | 01466434], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | subangularis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2 ♂♂ and 1 ♀: Peru, Cuzco [USNM]: 1 ♂ NVG- 23115 A 12 Qda. Morro Leguia, 1950 - 2150 m, GPS − 13.133, − 71.550, R. 30 - Aug- 1989, Robbins leg. (Fig. 41, right hindwing outer margin) and 1 ♀ NVG- 18045 B 08, USNMENT 01466433 Peru: Cuzco, Qbrda Buenos Aires, Cosñipata Rd., 2400 m, 19 - Nov- 2008, S. Kinyon leg. (Fig. 39 – 40, right side of the specimen) and 1 ♂ NVG- 18052 H 11 Bolivia (no detailed locality), H. Stichel collection no. 3334 [MFNB] (Fig. 42, right hindwing). Type locality. Argentina: Salta, west of Aguas Blancas, km 30 – 31 of the road to El Angosto, elevation 750 m.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDAFF23F9E59929F8EC.taxon	etymology	Etymology. The name of this new species is formed by adding a prefix sub- to the name of its sister species, given for the less angular shape of the hindwing, and is also made longer for this more southern species, living on the map “ below ” (i. e., sub-) of E. angularis. The name is a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9FFFDAFF23F9E59929F8EC.taxon	distribution	Distribution. Currently known from southern Peru, Bolivia, and northern Argentina. Emesis (Tenedia) paphia R. Felder, 1869 is a species distinct from Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 Genomic analysis reveals that Emesis paphia R. Felder, 1869 (type locality in Mexico: Veracruz), currently regarded as a subspecies of Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 (type locality in Venezuela) (Callaghan and Lamas 2004), is genetically differentiated from it at the species level (Fig. 3), e. g., their COI barcodes differ by 2.1 % (14 bp). In the presence of recognizable phenotypic differences — e. g., males of E. paphia are darker in ground color and typically have slightly rounder forewings with a broader orange band with more sharply defined and less diffuse edges compared to E. cypria — we propose to treat Emesis (Tenedia) paphia R. Felder, 1869, reinstated status, as a species-level taxon.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFDBFF23FF3A9FEDF9DD.taxon	description	(Fig. 3 part, 45 – 48, 107 – 108)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFDBFF23FF3A9FEDF9DD.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that a pair of specimens (Fig. 3 red) initially identified as Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 forms a clade sister to all other E. cypria - like specimens, including Emesis (Tenedia) paphia R. Felder, 1869, reinstated status (type locality in Mexico: Veracruz), and therefore represents a new species, which in COI barcode differs by 1.7 % (11 bp) from E. cypria and by 2.0 % (13 bp) from E. paphia. This new species is most similar to and sympatric with Emesis cypria cilix Hewitson, 1870 (type locality in Ecuador: Sarayaku and Mexico), at least in Alluriquin at 700 m (Pichincha, Ecuador), e. g., the specimen NVG- 18045 G 10 we sequenced. Phenotypically, males of the two species differ in the following ways: the discal narrow, wavy dark band on the forewing is not at the right angle towards the costal margin as in E. cypria cilix (the character mentioned in the original description), but is tilted slightly distad at costa, and is offset distad between veins M 3 and CuA 1 (more obvious on the ventral side), and the segment of the band in cell CuA 2 - 1 A + 2 A is not offset distad as strongly as in E. cypria cilix. In females, the yellow transverse band does not reach the forewing tornus. In male genitalia (Fig. 107 – 108), uncus is as long as tegumen, lower valval projection is less robust and stronger turned inward, the upper projection is rounder and broader in ventral view. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2063.5.4: A 71 G, cne 2024.5.4: T 75 G, cne 14049.3.3: A 19 C, cne 14049.3.3: A 108 G, cne 254203.4.6: G 58 A, and COI barcode: C 226 T, T 364 C, T 442 T, T 448 C, T 457 T, C 508 T, A 586 A. Barcode sequence of the holotype. Sample NVG- 18045 H 08, GenBank PQ 203557, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCCCATGGAGGATCCTCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCAGGTATCTCTTCTATT CTAGGAGCAATTAATTTTATCACCACTATTATCAATATACGAATTAATAACTTATCATTTGATCAAATACCTCTTTTTATTTGAT CAGTAGGTATTACTGCACTTTTACTTTTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFDBFF23FF3A9FEDF9DD.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 45 – 46, bears the following six printed rectangular labels, five white: [PERU: Piura: 3 km SW | Chinchin, 1800 m. | 04 42 ’ S 79 49 ’ W | 30 May 2000 | Robbins & Lamas Leg.], [DNA sample ID: | NVG- 18045 H 08 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 02 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 20 | Nick V. Grishin], [USNMENT | {QR Code} | 01466504], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | alisada Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1 ♀ NVG- 18095 C 03 Ecuador: “ Slanos ” [Los Llanos], old [MTD] (Fig. 47 – 48). Type locality. Peru: Piura Region, 3 km southwest of Chinchin, elevation 1800 m, approx. GPS − 4.700, − 79.817.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFDBFF23FF3A9FEDF9DD.taxon	etymology	Etymology. In Spanish, alisado means smoothed, flattened, or straightened. The name, treated as a feminine adjective, is given for the lack of the strong kink in the postdiscal band in males at the forewing vein CuA 2.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFDBFF23FF3A9FEDF9DD.taxon	distribution	Distribution. Currently known from the Andes of southern Ecuador and northern Peru.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFD8FF23F9A899DCFA2A.taxon	description	(Fig. 3 part, 49 – 52, 109 – 110)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFD8FF23F9A899DCFA2A.taxon	diagnosis	Definition and diagnosis. Genomic sequencing reveals that several specimens from Ecuador, Peru, and Bolivia (Fig. 3 purple) form a clade sister to Emesis (Tenedia) cypria C. Felder and R. Felder, 1861 (Fig. 3 blue) which, in the nuclear genome, is genetically differentiated from it at the species level with Fst / Gmin of 0.31 / 0.015. In the mitochondrial genome, however, the differences are small, e. g., 0.6 % (4 bp) in the COI barcode. This clade represents a new species, which is similar to E. cypria and differs from it by males with dark ventral forewing postdiscal band that is wider and stronger kinked at vein CuA 2, the segment in the CuA 2 - 1 A + 2 A cell is stronger offset distad than in E. cypria, and the two segments in this cell do not form into an arrowhead pointing basad. In male genitalia (Fig. 109 – 110), uncus is shorter than tegumen, lower valval projection is more robust and slightly tilted inward, the upper projection is more pointed and narrower in ventral view. Due to the cryptic nature of this species and poorly explored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 3772.6.14: C 28 T, cne 686.4.4: A 36 C, cne 686.4.4: A 78 G, cne 686.4.4: A 144 G, cne 1307.2.3: T 96 C, and COI barcode (may not always distinguish this species): T 364 T, T 442 C, G 586 G, A 628 A. Barcode sequence of the holotype. Sample NVG- 18045 H 03, GenBank PQ 203558, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATT ATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATACTAGGAGCCCCAGACATAGCTTTTCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCTCATGGAGGATCCTCAGTTGATTTAGCTATTTTTTCTTTACACTTAGCAGGTATTTCTTCTATT CTAGGAGCAATTAACTTTATTACCACTATCATCAATATACGAATTAATAACTTATCATTCGATCAAATACCTCTTTTTATCTGAT CAGTAGGTATTACTGCACTTTTACTTTTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACGGATCGTAATTT AAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFD8FF23F9A899DCFA2A.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 49 – 50, bears the following eight printed (text in italics handwritten) rectangular labels, seven white: [BOLIVIA: La Paz Province | San Lorenzo Valley | Rio San Lorenzo 800 m. | 15 ° 48.338 ’ S, 67 ° 29.447 ’ W, 12 - 19 April 2003 | Brian Harris, coll.], [ON DAMP SOIL | BY RIVER], [Emesis | cypria ♂ | det. Brian Harris 2003], [DNA sample ID: | NVG- 18045 H 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 03 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 21 | Nick V. Grishin], [USNMENT | {QR Code} | 01466499], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | flecta Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 3 ♂♂ and 1 ♀: Ecuador, Napo Province: 1 ♂ NVG- 18053 F 07 Santa Inés, R. Haensch S. leg, old, H. Stichel collection No. 3339 [MFNB]; 1 ♀ NVG- 18045 H 01, USNMENT 01466497 4 km E Puerto Napo, 500 m, − 1.050, − 77.783 (could be a mistake and this is the same locality as listed for the next specimen), 6 - 10 - Nov- 1988, D. H. Ahrenholz leg. [USNM] (Fig. 51 – 52); and 1 ♂ NVG- 18045 G 12, USNMENT 01466496 14 km E Puerto Napo, 470 m, − 1.050, − 77.683, 24 - Sep- 1991, D. H. Ahrenholz leg. [USNM]; and 1 ♂ NVG- 18045 H 02, USNMENT 01466498 Peru, Cuzco, Cosñipata Valley, El Mirador, km 68, elevation 1720 m, 25 - Oct- 2016, S. Kinyon leg. [USNM]. Type locality. Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, elevation 800 m, GPS − 15.8056, − 67.4908.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFD8FF23F9A899DCFA2A.taxon	etymology	Etymology. In Latin, flectus means bent, curved, or bowed. The name, a participle, refers to the orange band and its dark framing along the proximal margin bent near the ventral forewing tornus.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF99FFD8FF23F9A899DCFA2A.taxon	distribution	Distribution. Ecuador, Peru, and Bolivia.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9BFFD6FF23FA919824FC47.taxon	description	(Fig. 4 part, 53 – 54, 111 – 112)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9BFFD6FF23FA919824FC47.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that specimens from Mexico identified as Emesis (Poeasia) poeas Godman, 1901 (type locality in Mexico: Guererro, lectotype sequenced as NVG- 18081 G 07, NHMUK _ 010430896) partition into two clades (Fig. 4 purple and green) genetically differentiated from each other at the species level, e. g., their COI barcodes differ by 1.8 % (12 bp). One clade includes the lectotype of E. poeas, while the other one, more northern in distribution, corresponds to a new species. This new species is phenotypically similar to E. poeas and differs from it by being, on average, smaller, darker, and with a less contrasting pattern, i. e., more uniformly colored with weaker defined alternating grayer and more saturated in color reddish bands, and ventrally yellower orange rather than browner as E. poeas. In male genitalia (Fig. 111 – 112), valvae are less robust than in E. poeas (Fig. 113 – 114, NVG- 23111 B 11 Mexico: Oaxaca, Rt. 200 at Rio Huamelula, 16 - Jul- 1981, D. S. Bogar, J. C. Schaffner, and T. P. Friedlander leg. [CMNH]), the lower projection is stronger curved inward and terminally less rounded, the upper projection is laterally narrower and more curved dorsad; the posterior lobe in the middle of vinculum is larger, plate-like, trapezoidal, with more concave posterior margin. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 213.6.1: A 360 G, cne 562.20.2: A 522 C, cne 896.9.8: G 42 A, cne 3178.4.9: C 6 A, cne 3178.4.9: T 9 C, and COI barcode: T 212 T, C 235 T, T 250 T, A 382 A, T 418 T. Barcode sequence of the holotype. Sample NVG- 18044 G 03, GenBank PQ 203559, 658 base pairs: AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAGGATCTTTAATT GGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTCTTATATTAGGAGCACCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCTCCTTCATTATTTTTATTAAT TTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTA GCTATTTTTTCTTTACATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGTATTAATAATATATCAT TTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATT AACTGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGTGGTGGAGACCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9BFFD6FF23FA919824FC47.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 53 – 54, bears the following six printed rectangular labels, five white: [Riodinidae IX- 23 - 1987 | Emesis poeas M | Tepoca, Sonora, Mexico | Leg: John Kemner], [DNA sample ID: | NVG- 18044 G 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 04 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 22 | Nick V. Grishin], [USNMENT | {QR Code} | 00940216], and one red [HOLOTYPE ♂ | Emesis (Poeasia) | sonorensis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2 ♀♀: NVG- 18044 G 04, USNMENT 00940173 the same data as the holotype and NVG- 18052 H 06 “ Texas ” Fruhstorfer, H. Stichel collection No. 3304 [MFNB]. The locality of the last paratype is most likely in error. Type locality. Mexico: Sonora, Tepoca.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9BFFD6FF23FA919824FC47.taxon	etymology	Etymology. The name is formed from the name of the state with the type locality and is a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF9BFFD6FF23FA919824FC47.taxon	distribution	Distribution. Currently known only from Sonora in Mexico.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	description	(Fig. 4 part, 55 – 56, 115 – 116)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	diagnosis	Definition and diagnosis. This is a more northern species from the clade sister to Emesis (Brimia) temesa (Hewitson, 1870) (type locality in Ecuador) and is sympatric with it in Rondônia, Brazil. This new species is phenotypically similar to E. temesa and differs from it, including sympatric Emesis temesa peruviana (Lathy, 1904) (type locality in Peru: Junín) by the reduced red coloration of the ventral side, including much reduced red overscaling on ventral hindwing. Most notably, the forewing margin is brown (not largely reddish with a narrow brown frame towards the apex as is E. temesa) including part of the area with the submarginal row of black spots. In male genitalia (Fig. 115 – 116), the posterior lobe in the middle of vinculum is longer and more triangular, uncus is narrower and with a more prominent central bulge, saccus and the lower valval projection are longer, the upper valval projection is only slightly curved dorsad and outward. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 6505.1.20: G 347 A, cne 6505.1.20: T 366 C, cne 4919.1.4: T 36 C, cne 4919.1.4: A 111 G, cne 10177.13.11: T 75 C, and COI barcode: A 73 G, A 208 G, A 238 T, T 259 C, C 406 T, A 619 C. Barcode sequence of the holotype. Sample NVG- 18045 D 08, GenBank PQ 203560, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGTATGGAGTTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCTATT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	description	ATAATTGGTGGATTTGGAAATTGATTAGTACCTTTGATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGAT TCTGACTATTACCCCCATCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCCTCTAATATTGCACATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATT TTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CAGTTGGAATTACTGCTTTATTATTATTATTATCCTTACCAGTATTAGCAGGTGCCATCACTATATTATTAACTGACCGTAACTT AAATACATCCTTTTTTGACCCCGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 55 – 56, bears the following six printed rectangular labels, five white: [PERU, M. de Dios, Par- | que Manu, Pakitza 340 m | 11 ° 55 ’ 48 ” S 71 ° 15 ’ 18 ” W | 12 Oct 1991 | Leg. M. Cassagrande], [DNA sample ID: | NVG- 18045 D 08 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 05 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 24 | Nick V. Grishin], [USNMENT | {QR Code} | 01466457], and one red [HOLOTYPE ♂ | Emesis (Brimia) | apagada Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1 ♂ NVG- 18045 D 11 USNM 01466460 Brazil: Rondonia, vic. Caucalandia, − 10.533, − 62.800 10 - Oct- 1991, J. Mac- Donald leg. [USNM]. Type locality. Peru: Madre de Dios Region, Manu National Park, Pakitza, elevation 340 m, approx. GPS − 11.930, − 71.255.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	etymology	Etymology. In Spanish, apagado means extinguished or muted, referring to the reduced flaming coloration of the ventral side of this species. The name is treated as a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF94FFD7FF23FAC99824FC11.taxon	distribution	Distribution. From southeastern Peru to west-central Brazil.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF95FFD4FF23FC759F34FC13.taxon	description	(Fig. 4 part, 57 – 58, 117 – 118)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF95FFD4FF23FC759F34FC13.taxon	diagnosis	Definition and diagnosis. This is a more southern species from the clade sister to Emesis (Brimia) temesa (Hewitson, 1870) (type locality in Ecuador). This new species is phenotypically similar to E. temesa and Emesis (Brimia) apagada, new species (type locality in Peru: Madre de Dios), and differs from them by the hindwing being red beneath up to the postdiscal row of black spots and forewing brown margin being wider than in E. temesa, especially towards the tornus. In male genitalia (Fig. 117 – 118), the posterior lobe in the middle of vinculum is shorter and more trapezoidal with rounded angles and strongly concave in the middle, uncus is broader and with a smaller central bulge, saccus and the lower valval projection are shorter, the upper valval projection is stronger curved dorsad and very slightly inward. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 10024.5.4: T 69 A, cne 520.3.3: C 647 T, cne 520.3.3: T 675 C, cne 1657.3.4: A 66 G, cne 15996.2.4: T 24 C, cne 6505.1.20: G 347 G (not A), cne 6505.1.20: T 366 T (not C), cne 3772.15.9: T 120 T (not C), cne 3772.15.9: T 133 T (not C), cne 4809.1.3: T 156 T (not C), and COI barcode: T 88 C, T 163 C, C 586 C, T 595 T, T 634 C. Barcode sequence of the holotype. Sample NVG- 18045 D 10, GenBank PQ 203561, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGTATAGAATTAGGAACTTCAG GCTCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTCATACCTATT ATAATTGGTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGATTATTACCCCCATCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCTTCTAATATTGCACATGGAGGTTCTTCAGTAGATTTAGCTATTTTTTCCTTACACTTAGCAGGAATTTCTTCAATT TTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CAGTTGGAATTACTGCTTTATTATTATTATTATCCTTACCAGTATTAGCAGGTGCCATCACTATATTATTAACCGACCGTAATTT AAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF95FFD4FF23FC759F34FC13.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 57 – 58, bears the following seven printed (text in italics handwritten) rectangular labels, six white: [BOLIVIA: La Paz Province | San Lorenzo Valley | Rio San Lorenzo 800 m. | 15 ° 48.338 ’ S, 67 ° 29.447 ’ W, 12 - 19 April 2003 | Brian Harris, coll.], [Emesis ♂ | temesa | det. Brian Harris 2003], [DNA sample ID: | NVG- 18045 D 10 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 06 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 25 | Nick V. Grishin], [USNMENT | {QR Code} | 01466459], and one red [HOLOTYPE ♂ | Emesis (Brimia) | boliviana Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Bolivia: La Paz Province, San Lorenzo Valley, Rio San Lorenzo, elevation 800 m, GPS − 15.8056, − 67.4908.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF95FFD4FF23FC759F34FC13.taxon	etymology	Etymology. The name is formed from the name of the country with the type locality and is a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF95FFD4FF23FC759F34FC13.taxon	distribution	Distribution. Currently known only from the holotype collected in western Bolivia. Emesis (Aphacitis) parvissima Kaye, 1921 is a species distinct from Emesis (Aphacitis) lucinda (Cramer, 1775) Genomic analysis reveals that Emesis lucinda parvissima Kaye, 1921 (type locality in Trinidad, syntypes sequenced as NVG- 21037 B 02 and NVG- 21037 B 03) currently regarded as a junior subjective synonym of Emesis (Aphacitis) lucinda (Cramer, 1775) (type locality in Suriname) (Callaghan and Lamas 2004) is genetically differentiated from it at the species level (Fig. 5), e. g., their COI barcodes differ by 6.2 % (41 bp), and therefore is not synonymous with it. Moreover, the syntypes of E. lucinda parvissima, together with another specimen from Venezuela (NVG- 18044 B 08) that we identified as this taxon, form a clade sister to Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia) in the nuclear genome trees (Fig. 5 a, b) and distinct from it at the species level, e. g., their COI barcodes differ by 2.3 % (15 bp). In the presence of recognizable phenotypic differences — females of E. lucinda parvissima are darker, with smaller white apical spots on forewing compared to E. aurimna — we propose to treat Emesis (Aphacitis) parvissima Kaye, 1921, new status, as a species-level taxon.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF96FFD2FF23FA709F00FC75.taxon	description	(Fig. 5 part, 59 – 62, 119 – 120)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF96FFD2FF23FA709F00FC75.taxon	diagnosis	Definition and diagnosis. This is the northernmost species of the five revealed by genomic sequencing of the subgenus Aphacitis Hübner, [1819], as detailed above. This new species (Fig. 5 green) is sister to all other seven species in the clade with Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia) and most differentiated genetically from others, e. g., its COI barcode differs by 3.2 % (21 bp) from E. aurimna. This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in female: white forewing subapical area is less extensive and stronger separated from the wing margins by the ground brown color, both above and beneath, the ventral side is with submarginal inverted crescents connected with each other, not clearly separated as in E. aurimna, and dark web pattern is generally more extensive ventrally. Males have a stronger postdiscal dark band from costa to tornus on dorsal forewing, i. e., the postdiscal band visually merges into the submarginal band instead of bending basad as in other species; this bent portion from vein M 1 to the inner margin is present but is usually not as prominent as the submarginal branch; subapical forewing area is paler, but not strongly frosted with white scales, and ventral side is brighter orange compared to other species. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 16034.1.2: A 125 G, cne 16034.1.2: A 735 C, cne 6734.6.2: A 57 G, cne 6734.6.2: C 78 T, cne 2296.1.3: A 34 G, and COI barcode: T 226 C, A 229 G, T 250 C, T 550 C, T 574 C. Barcode sequence of the holotype. Sample NVG- 18044 B 04, GenBank PQ 203562, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGGATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATCGGAGGATTTGGTAACTGATTAGTTCCATTAATACTAGGAGCACCTGACATGGCTTTCCCACGAATAAATAACATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATCTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAACAATATGTCATTTGATCAAATACCATTATTTGTCTGAT CTGTTGGAATTACAGCCCTTTTACTTTTATTGTCTCTCCCAGTTTTAGCTGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF96FFD2FF23FA709F00FC75.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 59 – 60, bears the following six printed rectangular labels, five white: [Riodinidae VIII- 2 - 1988 | Emesis lucinda M | Agua Azul, CHIS, Mexico], [DNA sample ID: | NVG- 18044 B 04 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 07 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 26 | Nick V. Grishin], [USNMENT | {QR Code} | 00940155], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | aurichica Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratype: 1 ♀: NVG- 18095 C 02 Costa Rica (no detailed locality), 1903 [MTD] (Fig. 61 – 62). Type locality. Mexico: Chiapas, Agua Azul.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF96FFD2FF23FA709F00FC75.taxon	etymology	Etymology. The name for this E. aurimna relative from Chiapas and Costa Rica is formed as a fusion: auri [mna] + Chi [apas] + [Costa Ri] ca and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF96FFD2FF23FA709F00FC75.taxon	distribution	Distribution. Currently known from southern Mexico (Chiapas) and Costa Rica.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF90FFD3FF23FBD199EEFD5C.taxon	description	(Fig. 5 part, 63 – 66, 121 – 122)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF90FFD3FF23FBD199EEFD5C.taxon	diagnosis	Definition and diagnosis. This new species (Fig. 5 purple) is sister to both Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia) and Emesis (Aphacitis) parvissima Kaye, 1921, new status (type locality in Trinidad) in the nuclear genome trees, and therefore is distinct from either of them. In the COI barcodes, the difference is 2 % (13 bp) from E. aurimna and 2.1 % (14 bp) from E. parvissima. This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in female: white forewing subapical area is less extensive (but not as small as in E. parvissima), consists of smaller spots and not as prominently extending along veins towards the apex as in E. aurimna, and the apical separate white spot is smaller. Ventral hindwing is more similar to E. aurimna and E. parvissima in pattern, with submarginal inverted crescents separated from each other, with smaller spots there, white not prominently extending along veins towards apex, and the very apical separate spot is smaller as well. In males, white subapical frosting on the dorsal forewing is present (not vestigial as in E. parvissima) but less extensive than in E. aurimna; ventrally, wings are slightly yellower and weaker patterned. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 4410.1.5: G 204 A, cne 4410.1.5: G 210 A, cne 2706.1.64: A 165 G, cne 793.4.4: A 96 T, cne 793.4.4: A 165 G, and COI barcode: A 61 A, T 88 C, T 130 T, T 247 T, T 610 C. Barcode sequence of the holotype. Sample NVG- 18044 E 02, GenBank PQ 203563, 658 base pairs: AACATTATACTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAGTTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTGGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTCTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGTAATTT AAATACATCTTTCTTTGACCCTGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF90FFD3FF23FBD199EEFD5C.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 63 – 64, bears the following six printed rectangular labels, five white: [PANAMA: Darién | Canglón | 14. ix. 1980 | leg. G. B. Small], [DNA sample ID: | NVG- 18044 E 02 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 08 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 27 | Nick V. Grishin], [USNMENT | {QR Code} | 01466369], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | auripana Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 1 ♂ and 1 ♀ from Panama [USNM]: 1 ♂ NVG- 18044 C 12 USNMENT 01466357 Darién, Cana, 400 m, 20 - Sep- 1982, G. B. Small leg., genitalia # 2003 - 46, Donald J. Harvey; 1 ♀ NVG- 18044 E 01, USNMENT 01466368, Panamá, Taboga Island, 1 - Nov- 1983, J. F. G. Clarke (Fig. 65 – 66). Type locality. Panama: Darién Province, Canglón.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF90FFD3FF23FBD199EEFD5C.taxon	etymology	Etymology. The name for this E. aurimna relative from Panama is formed as a fusion: auri [mna] + Pana [ma] and is treated as a feminine noun in apposition.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF90FFD3FF23FBD199EEFD5C.taxon	distribution	Distribution. Central and eastern Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF91FFD0FF23FD299F23FE51.taxon	description	(Fig. 5 part, 67 – 68, 123 – 124)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF91FFD0FF23FD299F23FE51.taxon	diagnosis	Definition and diagnosis. This new species (Fig. 5 red) is sister to the clade that consists of Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia), Emesis (Aphacitis) parvissima Kaye, 1921, new status (type locality in Trinidad), and Emesis (Aphacitis) auripana, new species (type locality in Panama: Darién), in the nuclear genome trees, and therefore is distinct from all others. In the COI barcodes, the difference is 2.1 % (14 bp) from E. aurimna, 2.6 % (17 bp) from E. parvissima, and 2.0 % (13 bp) from E. auripana. This new species is phenotypically similar to others in the E. aurimna clade and differs from its relatives by a combination of the following characters in male (female is unknown): dorsal forewing heavily frosted with white scales in the apical quarter, frosting reaches vein CuA 2 along the outer margin, white scales present in the postdiscal area between costa and vein M 2, separated from the subapical white overscaling by a darker olive-brown inverted-L-shaped postdiscal band, submarginal dark spots are not developed, giving this species a more “ frosted ” appearance; ventral side orange, yellower in the middle of cells and darker along the veins and dark bands and spots, mostly orange along out wing margins, with dark spots towards forewing tornus and at the hindwing apex. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 23605.2.8: C 216 T, cne 3560.4.6: C 232 T, cne 6180.2.5: A 192 G, cne 471.1.1: A 802 C, cne 2676.3.1: T 487 C, cne 426.6.1: A 630 A (not G), cne 2343.2.13: C 183 C (not A), cne 2343.2.13: T 537 T (not C), cne 12832.2.1: A 218 A (not T), cne 5563.4.3: G 22 G (not C), and COI barcode: T 10 T, T 197 C, A 289 G, A 316 G, A 466 G, T 595 C. Barcode sequence of the holotype. Sample NVG- 18044 B 07, GenBank PQ 203564, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGACTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTGATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATGCGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAACTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF91FFD0FF23FD299F23FE51.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 67 – 68, bears the following six printed (text in italics handwritten) rectangular labels, five white: [PANAMA: DARIEN | Cana (Cerro Pirre) | 400 m | 7 ° 56 ’ N 77 ° 43 ’ W | 26 VII 1981 | leg. G. B. Small], [DNA sample ID: | NVG- 18044 B 07 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 09 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 28 | Nick V. Grishin], [USNMENT | {QR Code} | 01466341], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | pruinapicalis Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Panama: Darién Province, Cana, Cerro Pirre, elevation 400 m, approx. GPS 7.933 3, − 77.7167.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF91FFD0FF23FD299F23FE51.taxon	etymology	Etymology. In Latin, pruina means frost, and apicalis means apical or related to the apex. The name is given for the frosted apical part of the forewing and is a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF91FFD0FF23FD299F23FE51.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD0FF23FE359F23F936.taxon	description	(Fig. 5 part, 69 – 70, 125 – 126)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD0FF23FE359F23F936.taxon	diagnosis	Definition and diagnosis. This new species (Fig. 5 aquamarine) is sister to Emesis (Aphacitis) glaucescens Talbot, 1929 (type locality in Colombia: Montepa) in the nuclear genome tree and genetically differentiated from it at the species level. Although their COI barcodes do not differ strongly, by 1.4 % (9 bp), this difference is coupled with nuclear genome differentiation and phenotypic differences. This new species is phenotypically most similar to E. glaucescens and differs from it by a combination of the following characters in male (female is unknown): darker on both sides of wings, with reduced pale bluish-white frosting towards dorsal forewing apex, with dark submarginal spots in the frosted area, ventral side of wings with dark-brown margins, orangeyellow spots within this dark-brown border are lacking or vestigial, forewing submarginal area is orange and only slightly yellower than the ground color (not pale-yellow as in E. glaucescens). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2149.1.2: C 63 G, cne 2149.1.2: A 90 T, cne 392.2.10: C 100 T, cne 392.2.10: G 145 A, cne 3775.6.11: G 87 A, cne 10177.2.4: T 46 T (not C), cne 10177.2.4: T 42 T (not C), cne 865.2.5: C 159 C (not T), cne 13674.5.7: G 70 G (not A), cne 13674.5.7: A 75 A (not T), and COI barcode: 133 T, T 397 C, T 463 C, 481 G, 616 T. Barcode sequence of the holotype. Sample NVG- 18044 C 06, GenBank PQ 203565, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGCACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATCTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAACATACGTATTAATAATATGTCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTGTCTCTTCCAGTTTTAGCCGGAGCTATTACCATACTATTAACAGATCGTAATTT AAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD0FF23FE359F23F936.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 69 – 70, bears the following five printed (text in italics handwritten) rectangular labels, four white: [Panama: Darien | Cana 1000 m. | 4. IX. 1982 | G. B. Small], [Genitalia Dissection | # 2003 – 47 | Donald J. Harvey], [DNA sample ID: | NVG- 18044 C 06 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01466352], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) furvescens Grishin]. Type locality. Panama: Darién Province, Cana, elevation 1000 m.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD0FF23FE359F23F936.taxon	etymology	Etymology. In Latin, furvus means dark or dusky, and the name is formed similarly to the name of its relative E. glaucescens to mean becoming darker, given for the reduced bluish-white overscaling at the dorsal forewing apex and darker colors of the ventral side. The name is a participle.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD0FF23FE359F23F936.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD1FF23F9139F26FAE9.taxon	description	(Fig. 5 part, 71 – 72, 127 – 128)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD1FF23F9139F26FAE9.taxon	diagnosis	Definition and diagnosis. This new species (Fig. 5 magenta) is sister to both Emesis (Aphacitis) glaucescens Talbot, 1929 (type locality in Colombia: Montepa) and Emesis (Aphacitis) furvescens, new species (type locality in Panama: Darién) and genetically differentiated from them at the species level, e. g., their COI barcodes differ by 1.2 % (8 bp, moderate, but accompanied by the nuclear genome differentiation and phenotypic differences) from E. glaucescens and 2.0 % (13 bp) from E. furvescens. This new species is phenotypically most similar to E. glaucescens and E. furvescens in the general wing pattern of males (female unknown), e. g., all three species have a nearly solid-brown outer border (with pale spots in some species) on the ventral side of all wings and developed pale overscaling in the subapical area of the dorsal forewing, but differs from others by being paler overall, particularly in the ground color of the dorsal side and reduced white subapical frosting, thus is more similar in appearance of the dorsal side to Emesis (Aphacitis) aurimna (Boisduval, 1870) (type locality in Colombia). Ventrally with reduced brown bands and lines compared to E. glaucescens and E. furvescens, and more orange in the submarginal area of the forewing than E. glaucescens. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 213.7.2: G 664 T, cne 213.7.2: A 679 T, cne 1255.2.6: G 267 A, cne 1255.2.6: A 271 G, cne 1255.2.6: T 298 G, cne 953.8.8: T 93 T (not C), cne 953.8.8: G 108 G (not A), cne 2149.1.2: C 63 C (not G), cne 2149.1.2: A 90 A (not T), cne 6935.6.4: A 218 A (not C), and COI barcode: G 200 G, T 355 A, T 490 C, T 514 C, A 526 C. Barcode sequence of the holotype. Sample NVG- 18044 C 07, GenBank PQ 203566, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACCTCAG GTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGAGGATTTGGTAACTGATTAGTTCCATTAATATTAGGAGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCACCATCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCAAATATTGCCCATGGAGGAGCCTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCTATT TTAGGAGCAATTAATTTTATCACAACAATCATTAATATACGTATTAATAATATATCATTTGACCAAATACCATTATTTGTTTGAT CCGTTGGAATTACCGCTCTTTTACTTTTACTGTCTCTTCCAGTTTTAGCCGGAGCTATTACCATATTATTAACAGATCGTAATTT AAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD1FF23F9139F26FAE9.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 71 – 72, bears the following six printed rectangular labels, five white: [PANAMA: Panama | Cerro Jefe 900 m | 9 ° 14 ’ N 79 ° 22 ’ W | 1 April 1979 | leg. G. B. Small], [DNA sample ID: | NVG- 18044 C 07 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 10 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 29 | Nick V. Grishin], [USNMENT | {QR Code} | 01466353], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | pallescens Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Type locality. Panama: Panamá Province, Cerro Jefe, elevation 900 m, GPS 9.233, − 79.367.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD1FF23F9139F26FAE9.taxon	etymology	Etymology. In Latin, pallescens means becoming pale or turning pale. The refers to the paler tones of this species compared to its relatives, uses the same ending - escens, as other species in this group, and is a participle.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FF92FFD1FF23F9139F26FAE9.taxon	distribution	Distribution. Currently known only from the holotype collected in central Panama.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFACFFEFFF23FAC59995FBDB.taxon	description	(Fig. 5 part, 73 – 78, 129 – 130)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFACFFEFFF23FAC59995FBDB.taxon	diagnosis	Definition and diagnosis. Genomic analysis of specimens initially identified as Emesis (Aphacitis) condigna Stichel, 1925 (type locality Brazil: Pará, Santarém, lectotype sequenced as NVG- 18053 H 08) reveals that they partition into two clades genetically differentiated from each other at the species level (Fig. 5 brown and cyan), e. g., their COI barcodes differ by 2.3 % (15 bp). One clade includes the lectotype of E. condigna, thus representing this species, and the other clade corresponds to a new species. This new species is phenotypically most similar to E. condigna in having a prominent pale spot in the middle near the costal margin of the dorsal hindwing and differs from it by the discal dark dash in the dorsal hindwing cell M 3 - CuA 1 being somewhat offset distad from the line of connected dashes in anterior cells (the dash is aligned with others in the lectotype of E. condigna), and generally paler ventral side of wings, which is more heavily marked with dark framing, bands, and dashes in E. condigna. Additionally, it differs from closely related Emesis (Aphacitis) castigata Stichel, 1910 (Peru: Pozuzo, lectotype sequenced as NVG- 18053 H 07) by darker forewing apical area beneath, including the apex itself, which is more orange in E. castigata, and possesses a better-defined pale spot in the middle of the costal area of dorsal hindwing. In male genitalia (Fig. 129 – 130), falces are narrower, cornutus is more robust; in ventral view, the lower valval projection is narrower at the base and the upper projection is less rounded, more square-shaped. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 6600.5.10: T 61 C, cne 16584.1.1: T 63 C, cne 16584.1.1: G 93 C, cne 50888.1.8: A 36 G, cne 50888.1.8: A 63 T, and COI barcode: 250 T, 358 T, G 482 A, T 581 C, T 634 C. Barcode sequence of the holotype. Sample NVG- 18044 B 12, GenBank PQ 203569, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTCGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGTGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGAT TTTGACTTTTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAATATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGTATTAATAATTTAACATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTATTATCTCTTCCAGTTTTAGCAGGAGCTATTACTATATTACTAACAGATCGTAATTT AAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFACFFEFFF23FAC59995FBDB.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 73 – 74, bears the following six printed (text in italics handwritten) rectangular labels, five white: [PERU: Cuzco 540 m. | Villa Carmen | Pilcopata 4264 | 29 - IV- 2015 Kinyon], [DNA sample ID: | NVG- 18044 B 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23114 H 11 | c / o Nick V. Grishin], [genitalia | NVG 240817 - 30 | Nick V. Grishin], [USNMENT | {QR Code} | 01466346], and one red [HOLOTYPE ♂ | Emesis (Aphacitis) | andigna Grishin]. The first NVG number corresponds to a sampled leg, while the second refers to DNA extraction from the abdomen, followed by genitalia dissection. Paratypes: 2 ♂♂ from Peru: NVG- 18052 G 01 Monte Alegre, Rio Pachitea, old, G. Tessmann leg. [MFNB] (Fig. 75 – 76) and NVG- 18039 E 12 Puerto Maldonado, forest across Tambopata River from Explorer’s Inn Nature Reserve, 900 ’, 28 - Aug- 1985, J. Mix collection No. 13921 [FMNH] (Fig. 77 – 78). Type locality. Peru: Cuzco, Villa Carmen, Pilcopata, elevation 540 m.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFACFFEFFF23FAC59995FBDB.taxon	etymology	Etymology. A species from or near the Andes, closely related to E. condigna (means deserved, appropriate in Latin): And [es] + [cond] igna. The name is treated as a feminine adjective.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFACFFEFFF23FAC59995FBDB.taxon	distribution	Distribution. Currently known only from Peru.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFADFFECFF23FBAE9815FBD8.taxon	description	(Fig. 5 part, 79 – 80, 131 – 132)	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFADFFECFF23FBAE9815FBD8.taxon	diagnosis	Definition and diagnosis. Genomic analysis of a specimen from Southeast Brazil (Fig. 5 orange) that was identified in the collection as Emesis (Aphacitis) fastidiosa Ménétriés, 1855 (type locality in Brazil), probably due to locality, reveals that it is not closely related to this species and instead is sister to both Emesis (Aphacitis) condigna Stichel, 1925 (type locality Brazil: Para, Santarem, lectotype sequenced as NVG- 18053 H 08) and Emesis (Aphacitis) andigna, new species (type locality in Peru: Cuzco), thus representing a new species due to that and genetic differentiation from others, e. g., its COI barcode differs by 1.2 % (8 bp, low probably due to introgression) from E. condigna and by 2.6 % (17 bp) from E. andigna. This new species is phenotypically most similar to E. condigna, E. andigna, and Emesis (Aphacitis) opaca Stichel, 1910 (type locality in French Guiana) and differs from them and other in the subgenus Aphacitis Hübner, [1819] by a combination of the following characters: dorsal hindwing with a weakly defined pale spot in the middle near the costal margin (absent in E. opaca), the discal dark dash in cell M 3 - CuA 1 on dorsal hindwing that is strongly offset distad, as in Emesis (Aphacitis) fastidiosa Ménétriés, 1855 (type locality in Brazil) (the dash is mostly aligned with the anterior part of the discal band in E. condigna and weakly offset in E. andigna), more washed-out less distinct dark dashes on dorsal side, apex of forewing with significant dark overscaling beneath, not mostly orange as in Emesis (Aphacitis) castigata Stichel, 1910 (Peru: Pozuzo, lectotype sequenced as NVG- 18053 H 07). Males of the new species differ from the sympatric E. fastidiosa by rounder forewing outer margin, less produced forewing apex darker on both sides, smaller and sharper defined submarginal inverted lunules on ventral hindwing, and a discal bar in cell Sc + R 1 - RS nearly aligned with the bar in cell RS-M 1 (the latter is offset distad from the former in E. fastidiosa). In male genitalia (Fig. 131 – 132), the lower and upper valval projections are smaller and weaker separated from each other, rounded, knob-like. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 5787.2.15: G 27 C, cne 11414.2.6: A 69 G, cne 11414.2.6: T 18 C, cne 4293.8.1: A 13 C, cne 4293.8.1: A 22 T, cne 2256.1.1: A 1045 A (not T), cne 3201.5.1: A 64 A (not G), cne 3201.5.1: C 66 C (not T), cne 43189.1.2: G 462 G (not A), cne 939.13.9: C 182 C (not T), and COI barcode: T 181 C, G 200 A, T 463 C, T 542 C, A 586 G. Barcode sequence of the holotype. Sample NVG- 18053 F 06, GenBank PQ 203570, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCAG GTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATT ATAATTGGCGGATTTGGTAATTGATTAATCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAACATAAGAT TTTGACTTTTACCCCCCTCATTAATTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCC CCCACTTTCATCTAACATTGCCCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTCTCCATTTAGCTGGAATTTCATCTATT TTAGGAGCAATTAATTTTATTACTACAATCATTAACATACGTATTAATAATTTAGCATTTGATCAAATACCATTATTTGTTTGAT CTGTTGGAATTACAGCTCTTTTACTTTTACTATCTCTTCCAGTTTTAGCGGGAGCTATTACTATATTATTAACGGATCGTAATTT AAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFADFFECFF23FBAE9815FBD8.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 79 – 80, bears the following four rectangular labels (1 st green, last red and others white; 2 nd handwritten, others printed): [Brazil, Sao Paulo | Aracatuba | Oct. 1935 | ex coll. Arnold Schultze], [Aracatuba | Oct- 35 | Aze] (the last line is illegible and appears to be a short signature), [DNA sample ID: | NVG- 18053 F 06 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Emesis (Aphacitis) | luxata Grishin]. Paratype: 1 ♂ NVG- 23114 H 12 Brazil: São Paulo, 17 km W of Teodoro Sampaio, 600 m, GPS − 22.517, − 52.200 (GPS does not exactly correspond to the stated locality), 16 - Mar- 1991, R. Robbins, O. Mielke, and M. Casagrande leg., genitalia vial NVG 240817 - 31 (Fig. 131 – 132) [USNM]. Type locality. Brazil: São Paulo, Araçatuba.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFADFFECFF23FBAE9815FBD8.taxon	etymology	Etymology. In Latin, luxatus means dislocated and is given for the central spot in the hindwing discal band strongly offset distad in this species. Also, lux is Latin for light, fitting this brightly colored species. The name is a participle.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFADFFECFF23FBAE9815FBD8.taxon	distribution	Distribution. Currently known only from Southeast Brazil.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFAEFFEDFF23FBAE9988FE29.taxon	type_taxon	Type species. Emesis diogenia Prittwitz, 1865. Definition. In our first attempt to rationalize the genetic diversity of Emesis [Fabricius], 1807, we took a conservative approach and minimized the number of new subgenus names. As a result, we combined two phenotypically distinct clades in a subgenus that already had an available name: Aphacitis Hübner, [1819]. However, due to the recognizability of these two clades by observers in the field and the rather prominent genetic differentiation between them, each clade represents a subgenus of its own (Fig. 6). The clade consisting of closer relatives of Emesis lucinda (Cramer, 1775) (type locality in Suriname) corresponds to the subgenus Aphacitis. Its species are recognizable by their large size, bright orange ground color of ventral side in males (paler to pale yellow and nearly white in females) with a flipped-L, concave on the sides, brown postdiscal forewing band in both sexes and usually a large nearly white apical forewing spot in females. The second clade does not have an available name. Callaghan et al. (2024) demonstrated the utility of this clade as a taxonomic unit when they discussed species in this clade separately from Aphacitis, mentioning phenotypic similarity between them. Thus, this clade corresponds to a new subgenus. This new subgenus differs from its relatives by a combination of the following characters: the ventral side is mostly orange (females can be yellow or pale yellow) or with large orange bands and patches on wings, without a strong flipped-L postdiscal brown band on forewing and females are without a large, white forewing apical spot, submarginal spots on ventral hindwing usually well-developed and frequently larger near the apex and tornus, forewing postdiscal spots are mostly joined in a band composed of inverted crescents; aedeagus is shorter and stronger curved. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 5008.7.3: A 87 G, cne 5008.7.3: C 124 A, cne 7265.2.1: T 165 C, cne 7265.2.1: T 168 C, cne 7265.2.1: C 40 A, and in COI barcode: T 49 A, A 130 T, 517 T, T 538 A.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
03BF8783FFAEFFEDFF23FBAE9988FE29.taxon	etymology	Etymology. The name is tautonymous with the type species name and is a feminine noun in the nominative singular. Species included. The type species (i. e., Emesis diogenia Prittwitz, 1865), Emesis vulpina Godman and Salvin, 1886, Emesis tegula Godman and Salvin, 1886, Emesis heteroclita Stichel, 1929, and Emesis hypoaithos Callaghan, Trujano-Ortega, and Ríos-Málaver, 2024. Parent taxon. Genus Emesis [Fabricius], 1807.	en	Grishin, Jing Zhang Qian Cong Jinhui Shen Leina Song Nick V. (2024): Genomic analysis reveals hidden species diversity in Emesis Fabricius (Lepidoptera: Riodinidae). Insecta Mundi 2024 (82): 1-48, DOI: 10.5281/zenodo.14662420
