taxonID	type	description	language	source
0D1D878EFFE9FFD9FF12FA32FD4BA32E.taxon	description	[Fig. 1]	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE9FFD9FF12FA32FD4BA32E.taxon	materials_examined	Material examined. BMNH: 1904: 10.5.912 - 913, label- ed “ SYNTYPES 1904: 10.5.912 - 3 Perichaeta masatakae Beddard 1892 Coll. by Mr Masatake Rokugo ” (lapsus for Masataka Rokugo-cf. his Perichaeta rokugo). Two mature specimens, both previously dissected and rather macerated in mid-body, plus a spermatheca (9 lhs) in a small vial in the jar (Fig. 1). In order to enhance the stability of nomenclature, under ICZN (1999: Art. 72; et Decl. 44), the specimen newly figured (912) I hereby designate the LECTOTYPE since it was the basis of Beddard’s description (being donor of the removed spermatheca), it is 115 mm long but missing its posterior tip. Specimen (913) in the same jar, that had had its 18 lhs prostate duct and GM glands removed (missing), thus becomes the PARALECTOTYPE. Japan: Lake Biwa Museum (LBM 1380000087), from Hikone (collected 18. VI. 2009) four specimens that I initially mislabeled “ Metaphire spex ” or as A. robustus (as it was then known in 2010); NIBR (IV 0000251098), from Nogeyama, Yokohama, collected 4. VI. 2012 by RJB and T. J. Tansy, mature specimen found stranded and distress- ed on road in early evening after rain (dissected and figured, Fig. 1).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE9FFD9FF12FA32FD4BA32E.taxon	diagnosis	Diagnosis (from Beddard, pers. obs. and good references in synonymy above). Colour dark brown. Length 105 - 150 + mm by 4.0 - 7.5 mm wide; body cylindrical caudally tapering, segments 88 - 138. Lectotype and paralectotype 110 + and 130 mm, respectively the latter with 88 segments and a tapering tail (cf. 125 mm with 90 segments by Beddard for the same specimen), Nogeyama specimen 150 + mm, Ohfuchi (1938) has size up to 189 mm with 125 segments. Prostomium open epilobous. First dorsal pore at 11 / 12 or 12 / 13 in Ohfuchi’s specimens. Setae ca. 30 - 52 (40 - 50 in lectotype), (cf. 20 - 64 by Kobayashi). Spermathecal pores lateral in 7 / 8 and 8 / 9. Clitellum annular, 14 - 16. Female pore single on 14. Male pores superficial on 18 with 9 - 15 setae intervening. Genital markings small papillae, most with glands internally, typically immediately median to spermathecal pores anteriorly and posteriorly, i. e. in some of 7 - 9 (Kobayashi has them sometimes in successive segment 10); each male pore typically with two genital papillae just median, one presetal and one postsetal on 18 (Kobayashi has some in 19 too). [Note that in the Nogeyama specimen (Fig. 1) some markings lacked internal glands while at least one gland had no noticeable external manifestation, i. e., their pores may be superficial and easily overlooked and not all papillae appear to have glands]. Septa 5 / 6 / 7 and 10 / 11 - 13 / 14 thickened; 8 / 9 / 10 absent around muscular gizzard. Hearts in 10 - 13. Spermatheca paired in 8 and 9 each with oval ampulla and elongate or paprika-shaped diverticulum (GM glands often nearby). Testis in sacs in 10 and 11, seminal vesicles paired anteriorly in 11 and 12, pseudovesicles in 13 (what Beddard calls ‘ egg-sacs’ and Ohfuchi an ‘ ovisac’). Ovaries in 13, ovisacs absent from 14 (pers. obs.). Prostate glands absent with only curved prostatic duct in 18 (or present in some of Kobayashi’s specimens), GM glands adjacent. Intestine from 15, ½ 15, caeca simple with jagged inner edge originating from 26 - 28 [or simple and without indentations in Kobayashi’s (1938: 138) specimens], vascular and lamellar typhlosole starts from around 26 - 30 (in lectotype and Nogeyama specimen, pers. obs.) with guts mostly containing amorphous soil with some grits (geophagous diet). Behaviour. Ohfuchi (1938: 62) reported mostly clitellate specimens from organic soil near houses at 12 - 16 cm depth in Feb., 1937 that he thought indicative of hibernation.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE9FFD9FF12FA32FD4BA32E.taxon	distribution	Distribution and habitat. “ Japan ” (Beddard); Michaelsen (1903: 97) gave locality as Kamakura [mistakenly quoted by Kobayashi (1938: 139) as “ Yokohama ”] but this just for its erstwhile junior synonym, P. campestris; the report by Ohfuchi (1938) is from Wakayama-ken on the Kii Peninsula in the Kansai region. New material found at Nogeyama in Yokohama, between Tokyo and Amynthas robustus Fig. 2. Amynthas robustus type after original illustrations (Perrier, 1872: figs. 67 - 68). Kamakura, suggests an original location. For Korea, Kobayashi (1937, 1938) recorded it from Quelpart (= Jeju), several other smaller islands and from the mainland at Mokpo but, in light of current knowledge presented in the current paper, these are possible misidentifications of A. tralfamadore (or M. ryunome?) or some other taxon as noted in Remarks below. Chuang & Chen (2002) newly reported A. masatakae as an introduction to northern Taiwan at Mt Dongyan (1000 m elevation on fruit farms) but were mistaken to say this was the first record outside Japan (cf. Kobayashi, 1937, 1938). A. masatakae is now more restricted in its distribution compared to its treatment whilst in synonymy of A. robustus variously by Gates (1939), Ljungström (1971) and successively (cf. attempts to unravel the confusion of A. robustus by Blakemore, 2003, 2010 b and herein).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE9FFD9FF12FA32FD4BA32E.taxon	discussion	Remarks. When we carefully read Gates’ (1939: 474) voluminous account of Pheretima robustus we discover that in some cases he only considered citations of some species to be synonyms and, in other cases, the species themselves, these barely differentiated. Thus he claimed the Korean record of “ 1937. Pheretima masatakae KOBAYASHI, Sci. Rep. Tohoku Univ., ser. 4. vol. 11. p. 337 ” to be in synonymy and ignored all its other citations above, including the type description! Thus Gates (1939) is assumed by de facto default to have falsely given an impression of synonymy of the name P. masatakae in A. robustus. This misinterpretation thereby expanded not only the definition of both combined species, but also their ranges. Being an earlier described species, and possibly having parthenogenetic variability in spermathecae and genital markings as introduced by Gates’ bizarre scheme, allowed A. robustus in name to collect several synonyms in subsequent work, e. g. by Ljungström (1971) and Easton (1981), for specimens with two (or fewer?) pairs of spermathecae, ultimately accruing about a dozen synonymic names. Chuang & Chen (2002: 75) restored A. masatakae. However, the key character these authors gave for separation of A. masatakae from A. robustus - its lack of prostates-is not necessarily valid: Lack of prostates merely indicates parthenogenetic degradation and it is entirely permissible for sexual forms to occur under this species’ name, possibly in manifestations not dissimilar to A. robustus or to any of a dozen other taxa, as (validly or invalidly) included under this name by Gates (1939) and successively (full A. robustus synonymy provided in Blakemore, 2010 b). Meanwhile, Amynthas campestris (Goto & Hatai, 1898: 67) has prostatic glands, but its synonymy by Beddard (1900) is unacceptable, due not to its glands but rather to the fact that its spermathecal pores are possibly closer together, and, moreover, its GMs certainly differ being post-setal pairs in 7 & 8 and 17 - 19 approximately as wide as the spermathecal pores in 7 / 8 / 9. Its true relationship to A. robustus is yet to be determined. Conversely, Ohfuchi’s (1938: 65) suggestion that closely similar A. parvicystis (Goto & Hatai, 1899: 18) is not a synonym of A. masatakae merely because spermathecae in the former were said to be located in 7 & 8 while in the latter they are in 8 & 9, is perhaps less of a valid reason due to known flaws in his mentor Hatai’s work whereby he frequently miscounted segments (e. g. for A. carnosus as shown in Blakemore, 2012 a). Described with spermathecal pores anteriorly in 7 & 8 and with GMs in 6 / 7 / 8 (their fig. 8, here Fig. 3), but these are probably vice versa transposition mistakes (i. e., spermathecae in 6 / 7 / 8 and markings in 7 & 8) making it superficially similar to A. tokioensis. Then again, the spermathecal pores may be mistaken (as for their P. vesiculata and P. carnosa!) and actually occur in 7 / 8 / 9, in which case this name is possibly a synonym of A. masatakae proper. VII VIII XVIII Fig. 8 In an instance of further confusion, Hatai in Goto & Hatai (1899) described A. parvicystis with a single pair of caeca having “ external margins frizzled ” said to be similar to the condition found in Amynthas digitatus (Benham, 1896) and A. bonthainensis (Benham, 1896). Sims & Easton (1972: 173, fig. 1 I) show A. digitatus with multiple (= manicate) intestinal caeca although Hatai may not have known this. Moreover, Goto & Hatai (1899: 23) fail- ed to include A. parvicystis in their list of species with manicate caeca (although they also miss their own agrestis and mistakenly include divergens in this list), and they had earlier overlooked the caeca of their P. iizukai as well as misdescribing the multiple caeca of their P. megascolidioides. Possibly the caeca were single but incised and if so, plus its spermathecae were really in 8 & 9, then it would be similar to specimens reported from Kyushu by Yasuaki Sugi (unpublished http: // www. geocities. jp / homantaro / AmyMeta / AmyMeta 1. doc, http: // www. geo cities. jp / homantaro / AmyMeta / Robustus. htm, April, 2012) under the name “ Amynthas robustus (Perrier, 1872)? ” that are, however, now seemingly closer to A. masatakae as revived herein. Nothing resembling Goto & Hatai’s A. parvicystis has been reported since its original definition [except for a dubious report by Kobayashi (1941 a)] and, although it is probably a poorly-described junior synonym of A. masatakae, if its caeca are indeed manicate, most likely it is yet another synonym of A. tokioensis [for which Ishizuka’s Ph. verticosa is also a synonym with his figures (Ishizuka, 1999 b: 50, figs. 75 - 83) complying almost exactly with Goto & Hatai’s parvicystis figures]. Perhaps the most sensible policy, for the time being at least, is to treat A. parvicystis as a species incertae sedis or dubius. In the present author’s current view, the way that A. robustus proper differs from Beddard’s A. masatakae, according to Perrier’s original description and figures (presented here as Fig. 2) are its genital markings in 8 & 9 directly below the spermathecal pores plus a pair mid-ventrally and presetally between the male pores. The spermathecal diverticula also appear longer (Fig. 1 vs. Fig. 2). Another differentiating characteristic, as describ- ed by Perrier (1872: 116) is “ deux coecums lisses ” (two smooth caeca) from segment 26, while the inner edge of the caeca in A. masatakae are indented or serrate. Compare this to Kobayashi’s (1938) account where the caeca are without indentations, and to Ohfuchi (1956) who describes serrate caeca plus markings between the male pores, and see A. tralfamadore and M. ryunome herein. Gates (1939: 479) has his “ Pheretima robusta ” with caecal margins incised but this not based on its types and, as already noted, his work is very confused (he provides no figures), quite unreliable (his errors go unchecked) and highly suspect. Types of Amynthas robustus will need to be checked for details of genital markings, spermathecae and smoothness of their caeca. Without inspection of these, Gates (1939) then Ljungström (1971) discussed supposedly parthenogenetic forms of Pheretima robusta, and considered (parts?) of both P. aspergillum and P. masatakae to be synonymous. However, types of A. masatakae (Fig. 1) and some specimens (including some of Kobayashi’s Korean specimens that seem mostly compliant despite some retaining prostates) from the synonymy presented above, differ from A. robustus in their markings being typically small and paired mesially on inner sides of spermathecal and / or male pores, but typically not mid-ventral on 18. Kobayashi (1937) described “ masatakae ” specimens from Korea, some with prostates, that lacked marking between the male pores as in masatakae yet had smooth caeca as in robustus (and ryunome herein); conversely, Ohfuchi (1956: 155, 160) described prostatic “ masatakae ” specimens from Okinawa having both mid-ventral markings on 18 as in robustus and serrate caeca as in masatakae. Ohfuchi confounded his descriptions by putting these specimens under two names: “ Pheretima masatake ” [sic lapsus pro masatakae] and P. lauta Ude, 1905: 405 - this latter with synonyms P. siemsseni Michaelsen, 1931: 17 and P. fokiensis Michaelsen, 1931: 19 types of which were inspected by Gates (1939: 420) under the species name Pheretima aspergillum (Perrier, 1872) along with its other erstwhile synonyms P. takatorii (Goto & Hatai, 1898) and P. corrugata Chen, 1931: 131. This latter taxon was also allegedly redescribed by Ohfuchi (1956: 162) from Okinawa. Nevertheless, it seems likely that both Kobayashi (1937; 1938) and Ohfuchi (1956) were describing specimens that would now qualify for neither A. robustus nor A. masatakae, i. e., they possibly represent one or more new and undescribed taxa (cf. Amynthas tralfamadore and Metaphire ryunome herein). Thus, while appearing intermediate between robustus and masatakae, yet possibly more compliant with the former, these Okinawan and Korean specimens require revaluation with all earlier species’ types and also with Taiwanese specimens attributed to either species names of robustus or masatakae, allowing in each case for parthenogenetic degradations (as noted by Blakemore, 2003), i. e., with reduced relevancy of prostates, spermathecae and GMs as key defining characteristics. Intestinal caecal indentations are perhaps unreliable characters too and may vary interspecifically (as noted by Sims & Easton, 1972 and Blakemore, 2003). Moreover, Amynthas aspergillum (Perrier, 1872) should, for the time being at least, remain separate retaining its supposed synonyms: Perichaeta takatorii Goto & Hatai, 1889 and Pheretima paraglandularis Fang, 1929, albeit Chen (1959: fig. 13) shows its intestinal caeca deeply incised whereas Chang et al. (2003: fig. 9) have them smooth. It is further possible that A. robustus proper has non-superficial male pores in which case it would qualify for genus Metaphire as for M. ryunome sp. nov. below.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFEDFFD6FF12FAB2FE3AA449.taxon	description	[Figs. 4 - 6]	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFEDFFD6FF12FAB2FE3AA449.taxon	materials_examined	Material examined. Neotype NMST An 446 from Saito Ho-on Kai collection: (sample tube # 19) labeled “ Ph micronaria Goto & Hatai ” with location and collector not noted; one of two previously undissected matures here dissected and sketched (90 mm long with markings in 17 / 18 & 18 / 19); the other, specimen NMST An 447 (100 mm long with markings in 17 / 18 only). Specimen (90 mm long) NMST An 445 (tube # 18), a previously undissect- ed mature specimen, here dissected and sketched, label- ed “ Ph sp Sendai, Naga-machi, Kamohara’s home (in kanji) 16 / VI / 1931 ” collector not noted. UMUTZ-Ann- OG- 35 remnant labels written by Professor S. Goto or Dr S. Hatai had: “ Perichaeta micronaria Tokyo ” + “ No. 4 ” + “ 6 / 91 ” [June 1891?]; two damaged specimens, seemingly mature, that whilst on loan had been allowed to dry out and are now in poor condition, i. e., contemporaneous topotypes but since neither was dissected they were probable, but not proven, actual syntypes. Also UMUTZ- Ann-OG- 36 labeled “ Perichaeta micronaria ” with kanji for Meiji 29 and 8 th month [= August 1896] from “ Tozaki, Kikkuchi, Kumamoto-ken collected by Mr Takiyama ” - a batch containing many life stages of Amynthas corticis species-complex and possibly A. micronarius with at least one dissected (110 mm long and with GMs in 17 / 18 only) but, as noted by Blakemore & Ueshima (2011), not syntypes because this was not the stated “ Tokyo ” type-locality. Note: Both the Tokyo Museum and Tokyo University lots of these historical specimens had been loaned out by Mr Ishizuka since 1981 - more than thirty years previously-but their significance was seemingly unrealized and this crucial material was ignor- ed and unpublished without distracting from numerous “ new ” species, many of which were homonyms and most of which were synonyms as noted above and by Blakemore (2003; 2008; 2012 a; 2012 b) and by Blakemore & Ueshima (2011). A Watarase, Tochigi-ken specimen unregistered in Yokohama National University (YNU), collected by Dr T. Kamitani April, 2003 from his Control site R (dissected and sketched by RJB). Kamakura specimens collected by RJB, Yuko Hiramoto & Amanda Reed, 12 th April 2004 from Kuzuharagaoka Shrine along with seven other species; plus other specimens collected by RJB from bamboo groves and organic farms at Ami, Ibaragi-ken 27 th July 2006 (all in YNU collection). Japanese specimen (NIBR IV 0000249941) posterior amputee, mature, collected by RJB and T. J. Tansy 23 rd May 2012 from Nogeyama, Sakuragi-cho, Yokohama, Japan. Korean specimen (NIBR IV 0000246442) collected by RJB 19 th March 2012 from NIBR Incheon’s Jeju Island Biosphere display along with A. tralfamadore Blakemore, 2012 and an immature lumbricid (IV 0000246443) - this paper’s subjects. Jeju-do Island specimens (NIBR IV 0000250396 - 7) 8 mature specimens, collected by RJB, TaeSeo Park & Insul, 21 st June, 2012 from Hyonyungsa Temple, Mt Halla, Jeju-do (thus newly confirming its presence on the mountain).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFEDFFD6FF12FAB2FE3AA449.taxon	description	Description. Colourless (partly transparent) or pale pinkish grey in life, a light buff or grey in alcohol with clitellum either darker or lighter (some specimens darker). Length ca. 49 - 120 mm by 2.5 - 4.5 mm with 61 - 110 segments [neotype 90 mm long with 80 segments; stated as either 66 or 55 mm with either 106 or 102 segments by Goto & Hatai (1898: 74 vs. tab. 1); Ohfuchi’s specimens and Ishizuka’s synonyms range 66 - 119 mm and 90 - 120 mm, respectively; Ohfuchi’s obtusa body lengths vary 49 - 54 mm]. First dorsal pore (often minute) in 11 / 12. Setae 25 - 51 [Goto & Hatai have 28 - 32 in spermathecal segments and 35 + more posteriorly; Ohfuchi (1937: 52) details 25 - 51 in forty-six specimens; Korean specimens have ~ 40 on segment 12 and 48 + further back]. Spermathecal pores four pairs in 5 / 6 / 7 / 8 / 9 (e. g. neotype) or three pairs in 6 / 7 / 8 / 9 if anterior pair absent (e. g. An 445, some Ibaragi specimens and synonyms) or, possibly, fewer spermathecae (synonyms), ca. 0.3 C apart. [Note: Spermathecal circumferencal ratios may be calculated in various ways as from the camera lucida figures but mean little in soft-bodied worms having different preservation techniques]. Male pores superficial on segment 18 with 7 - 12 setae intervening (Goto & Hatai say “ 8 ” but show 10) or absent in some morphs. Genital markings paired anteriorly in 18 and 19 but mostly appearing intersegmental in 17 / 18 (e. g. specimen An 447) or 17 / 18 & 18 / 19 (neotype and An 445) just median to the lines of the male pores, some morphs lack one or more GMs, but when present glands correspond internally. Prostates as figured (sometimes aborted). Septa 8 / 9 and 9 / 10 aborted (sometimes partially). Spermathecal diverticula clavate or variously degraded and / or deleted: often adiverticulate or partially stalked, or small terminal diverticular bulbs may be present (sometimes filled with coagulum but not necessarily iridescent). Hearts in 10 - 13. Holandric with testis in sacs in 10 and 11 (not always iridescent), seminal vesicles in 11 & 12. Intestine from 15 or 16; intestinal caeca from 26 or 27 simple with smooth margins; intestinal typhlosole vacularized and lamellar from ca. 26. Gut contains soil with few grits and often charcoal grains, i. e. geophagous. Behaviour. “ The motion of this worm is very active and swift, and when dug from the ground, they wriggle and bounce about very quickly ” (Ohfuchi, 1937: 50).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFEDFFD6FF12FAB2FE3AA449.taxon	distribution	Distribution and habitats. Type-locality in Tokyo. Regarding the neotype, it is unknown but localities of other specimens in the collection included Komaba, Tokyo according to Ohfuchi (1937: 113). A species obviously subject to transportation that masks its origin; in Japan it occurs from Hokkaido to Ryukus (Easton, 1981). Newly recorded from Korea, the NIBR specimen’s probable provenance from Jeju, subsequently supported on material recovered at Mt Halla (RJB pers. obs.). Japanese material from around shrine gardens, farms and other disturbed sites, or “ generally found near houses ” (Ohfuchi, 1937). Under moss at NIBR Jeju facility. Under rocks at Nogeyama park. In soil near graveyards at Mt Halla Temple, Jeju. mt DNA COI data for Amynthas micronarius samples: Tokyo neotype NMST An 446 - nil result. Specimens, NMST An 445 and An 447 - nil results.> WO 1 Korean A. micronarius specimen IV 0000246442 from NIBR’s Jeju biosphere: TTTATACTTCATCTTAGGGATCTGAGCCGGAAT AATTGGTGCCGGAATAAGATTACTCATTCGAGT CGAATTAAGACAACCCGGACCATTTCTAGGTAG GGATCAACTATACAATACAATTGTAACCGCACA CGCATTCTTAATAATCTTCTTTCTAGTAATGCCA GTATTTATTGGAGGATTTGGAAATTGATTACTA CCTCTAATGTTGGGAACACCAGATATAGCATTC CCACGTCTAAATAACATGAGATTTTGATTATTA CCTCCGTCACTTATTTTACTCGTTTCATCTGCAG CCGTAGAAAAAGGAGCGGGAACAGGGTGAACA GTATACCCCCCGCTAGCAAGAAACATTGCCCAT GCCGGGCCATCAGTAGACCTTGCAATTTTCTCA CTACACTTAGCAGGAGCCTCCTCAATTTTAGGG GCAATTAACTTTATTACTACAGTAATTAACATG CGATGATCGGGACTACGCTTAGAACGAATTCCC CTATTCGTATGGGCAGTCGTAATCACCGTAGTA TTACTTCTTCTATCACTACCAGTATTAGCGGGA GCCATTACAATACTTCTTACAGACCGAAACCTT AACACATCGTTCTTTGATCCAGCAGGTGGGGGG GACCCTATTCTATACCAGCACCTGTTTTG BLASTn ver. 2.2.26 + (http: // www. http: // blast. ncbi. nlm. nih. gov / June, 2012): Identities = 634 / 634 (100 %), Gaps = 0 / 634 (0 %) for GenBank AB 542498 - AB 542501 “ Amynthas micronarius ” vouchers from Miyagi, Niigata, Hyogo and Kagawa-ken, Japan (http: // www. ncbi. nlm. nih. gov / genbank / June, 2012). Thus identity is supported.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFEDFFD6FF12FAB2FE3AA449.taxon	discussion	Remarks. Ishizuka’s Pheretima hinoharensis is likely synonymous (previously in Amynthas corticis species-complex), the glands near the spermathecal pores rather irrelevant in parthenogenetic polymorphs, or possibly underdeveloped or overlooked in other specimens. Moreover, Ishizuka’s Pheretima hypogaea and P. edoensis with three pairs of spermathecae are exactly similar, and so too is his P. tamaensis with two (adiverticulate) pairs. All three are mere morphal variations belonging to Goto & Hatai’s prior taxon. Anterior spermathecae in ‘ typical’ specimens of A. micronarius are often atrophied as if in the process of disappearing as indeed often occurs, indicative of involvement in a polymorphic complex. Thus two other NSMT specimens are mostly identical to the neotype (An 446), apart from one (An 445) lacking the anterior pair of spermathecae and one (An 447) having markings in 17 / 18 only. The new Korean and Japanese specimens comply with the species diagnosis, including figured specimens from Watarase and NIBR (as also in the P. subterranea synonym), where one worm has all three spermathecal diverticula states: from diverticulate or stalked only to adiverticulate, demonstrating the inconsequence of this character. The current synonymy above now requires comparisons with Korean Amynthas bamsagolensis Hong & James, 2001 that, following Blakemore (2012 a), is held under A. carnosus (Goto & Hatai, 1899), and with A. sangumburi Hong & Kim, 2002: 198 also from Jeju Island that appears an indistinguishable syn. nov. of Amynthas subrotunda (Ishizuka, 2000) comb. nov. itself provisionally held in an Amynthas corticis species-complex in a review by Blakemore (2003) 10 years earlier. Amynthas shimaensis and A. yamizoyamensis are retained as described below.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	description	[Fig. 7]	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	diagnosis	Diagnosis. Amynthas with spermathecal pores lateral in 7 / 8 / 9. Genital markings near spermathecal and male pores. Intestinal caeca simple with rugose inner face from 27. Spermathecal diverticula rounded rather than elongate and dorsal pores from 9 / 10.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	materials_examined	Material inspected. Holotype (H), NIBR IV 0000246 441, mature specimen fixed and stored in 80 % ethanol (EtOH), here dissected and figured (Fig. 7), collected 19. III. 2012 by RJB & JooLae Cho of NIBR.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	etymology	Etymology. After writer Kurt Vonnegut’s fictional biosphere reserve and exhibition.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	description	Description. Length 125 mm, segments 125. A dark chocolate brown anterior dorsum with faint mid-dorsal line, clitellum darker and ventrum pale. Dorsal pores minute in 9 / 10 open from 10 / 11. Setae 46 - 50 per segment around segment 12, up to ca. 70 after clitellum. Spermathecal pores ca. 0.4 circumference apart in 7 / 8 / 9. Genital markings as small opposed discs just median to spermathecal pores paired either side in 7 / 8 (only one unilateral after 7 / 8 rhs) and in 8 / 9 (plus one ‘ rogue’ unilateral after 9 / 10 lhs); similarly on either side of 18 just ventral to flat male pores. Internally, small stalked glands correspond to the external genital markings. Peptonephridia fill 5 and 6, septa to 7 / 8 are thin and absent in 8 / 9 / 10 where muscular gizzard occurs, and after this they are also thin. Nephridia meroic. Spermathecae in 8 and 9 each having round ampulla on short duct with rounded clavate diverticulum. Dorsal vessel single; hearts in 10 - 13. Metandric, testis possibly reduced in 10 but only found in 11 and there not iridescent; seminal vesicles larger posteriorly in 11 and smaller anteriorly in 12. Ovaries and funnels in 13. Prostate glands aborted and only short muscular ducts remain. Oesophagus only slightly dilated in 14 - ½ 15; intestine origin in 16 with simple caeca from 27 that are unusual in having a paler rugose and capillaried interior face extending forward to ca. 24. Thin lamellar typhlosole commences around 27. Gut contains organic soil and larger grits.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	distribution	Distribution. Korea, Incheon NIBR facility, possibly introduced from Jeju Island. mtDNA COI Barcode result:> WO 2 A. tralfamadore Holotype IV 0000246441 from NIBR’s Jeju biosphere: GTGTTGGTATAGGATTGGATCTCCCCCTCCTGC TGGATCAAAGAATGATGTATTGAGGTTTCGATC TGTTAGTAATATGGTAATTGCCCCTGCCAGTAC AGGTAGGGACAATAGTAATAGTACTACAGTGA TTACTACTGCTCACACAAATAGTGGGATTCGTT CTAGACGTAACCCAGATCATCGTATGTTAATTA CTGTTGTGATAAAGTTAATAGCTCCAAGAATTG ACGAGGCACCTGCAAGATGAAGTGAGAAAATT GCAAGGTCTACTGAAGGACCGGCATGTGCTATA TTTCTTGCTAAGGGTGGGTAAACTGTTCAACCT GTGCCAGCCCCCTTTTCTACCGCGGCAGATCTT ACCAATAAAATTAATGATGGCGGGAGTAGTCA AAATCTTATGTTATTTAATCGAGGGAACGCCAT ATCTGGGGTTCCAAGTATTAGGGGTAGTAACCA GTTTCCGAATCCACCAATAAATACTGGCATTAC TAGAAAGAAGATTATTAAAAATGCATGTGCTGT TACAATTGTATTATATAGCTGGTCCCTACCAAG GAAGGATCCAGGTTGTCTTAACTCAATACGAAT AAGTAGTCTTATTCCTGCACCAATTATTCCTGCT CAAATTCCTAGAATAAAGTATAGGG megaBLAST showed no match better than 94 % for voucher specimens, neither based on types, of AB 542 533 “ Amynthas robustus ” from Japan or EF 077538 “ A. triastriatus ” from China (an erstwhile synonym of M. masatakae), or only 85 % of max identity for DQ 224191 “ A. robustus ” from Taiwan (cf. M. ryunome sp. nov.).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE2FFD7FF10FD5CFEE9A04D.taxon	discussion	Remarks. A parthenogenetically degraded species, lacking prostate glands as with A. masatakae, nevertheless, in the key of Sims & Easton (1972) its incipient metandry corresponds to an A. martiorum - group. If holandric it would approach the large A. aeruginosus - group that contains both A. robustus and A. masatakae. Distinctive characteristics of A. tralfamadore are the shape of spermathecae with the diverticula bulb spherical rather than elongate as in A. robustus or “ paprika-shaped ” in A. masatakae - although the importance of this in parthenogenetic morphs is perhaps debatable-and its inner face of intestinal caeca perhaps more rugose than in A. masatakae types. Moreover, its paired sets of markings in 18 are slightly wider apart on each side compared to those in the A. masatakae types (Fig. 1). Its mtDNA COI barcode data serves to definitively characterize this species. Although type-locality is the NIBR facility, its origin has yet to be clearly determined. The Jeju-do display uses bagged potting soil for bulking, but worms may have been accidentally introduced around roots of trees and shrubs and flowers directly imported from the Island or indirectly via plant nurseries. This survey only took about 10 minutes and probably other species of earthworms are yet living in the facility, despite periodic replacement of the soil (pers. obs.), but a more extensive search was curtailed in order to protect the public display.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE3FFD0FF12F95EFD7BA2CE.taxon	description	[Fig. 8].	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE3FFD0FF12F95EFD7BA2CE.taxon	materials_examined	Material examined. Single mature specimen unregister- ed in Yokohama National University (YNU) SERG earthworm collection, from high mountain plains, Mt Fuji, Shizuoka-ken, Japan collected 8 th November, 1998 by To- 10 Amynthas shimaensis moko Uchida.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE3FFD0FF12F95EFD7BA2CE.taxon	description	Description. Dark grey dorsum with intersegments not noticeably darker nor paler, clitellum puce in Fuji specimen versus dark flesh colour with darker intersegments in Goto & Hatai’s specimen. Length 150 mm with 132 segments (205 and 163 segments in Goto & Hatai). First dorsal pore in 12 / 13 (Fuji specimen and Goto & Hatai’s account). Setae ca. 50 before clitellum and ca. 60 after in Fuji specimen (Goto & Hatai have about 85 in the genital segments). Spermathecal pores four pairs in 5 / 6 / 7 / 8 / 9 about 0.25 of circumference apart. Male pores superficial on segment 18 with about 10 - 13 setae intervening (Goto & Hatai have them separated by 13 setae but only show 11 in their fig. 3). Genital markings paired posteriorly in 19 encroaching in 19 / 20 with solid gland corresponding internally. Septa 8 / 9 and 9 / 10 aborted. Spermathecal diverticula clavate and convoluted (or “ winding ” in Goto & Hatai). Last hearts in 13. Holandric with seminal vesicles in 11 & 12. Intestine from 15; intestinal caeca from 26 or 27 simple with incised ventral margins (in Fuji specimens at least). Lamellar typhlosole from ca. 27 (pers. obs.).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE3FFD0FF12F95EFD7BA2CE.taxon	distribution	Distribution. Japan, Mie-ken, Kansai [that Easton (1981: 55) mistakes as “ GUMMA ” (= Gunma-ken) in Kanto], and now possibly Mt Fuji in Shizuoka-ken.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE3FFD0FF12F95EFD7BA2CE.taxon	discussion	Remarks. Amynthas shimaensis (Goto & Hatai, 1899) is restored from synonymy in A. micronarius (Goto & Hatai, 1898). However, the major problem now is that the only difference between A. shimaensis and the prior Amynthas grossus (Goto & Hatai, 1898: 75) - provisionally in synonymy of A. fuscatus (Goto & Hatai, 1898: 66) after Easton (1981: 57) along with ten other synonyms from Blakemore (2003: 19) - is posterior markings additional to those in 19 (or absent). Both taxa typically have winding spermathecal diverticula. Although not mentioned by Goto & Hatai, all these species appear to share incised intestinal caeca, at least in mature worms and, accepting this, the current specimen agrees tolerably with their description of A. shimaensis. Proper resolution requires new material from its Shima, Mie-ken type-locality. Alternatively, this Fuji specimen may actually correspond to Amynthas grossus once it is separated and remov- ed from A. fuscatus, but such acts are deferred pending further studies from Japan.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD0FF10FADFFB33A015.taxon	description	[Fig. 9].	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD0FF10FADFFB33A015.taxon	materials_examined	Material examined. None-fate and location of the original four syntypes unknown.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD0FF10FADFFB33A015.taxon	description	Description. Pinkish grey colour. Length, 136 - 177 mm, segments 117 - 136. Setae 25 - 48. Spermathecae in 5 / 6 / 7 / 8 / 9. GMs large paired in 17 / 18. Male pores, superficial but “ elevated ” and separated by 7 - 10 setae. Presence of septa 8 / 9 / 10 unrecorded. Spermathecal diverticula variable as short stalks to long coiled ducts. Seminal vesicles in 11 and 12. Intestine from 15, caeca simple from 28.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD0FF10FADFFB33A015.taxon	distribution	Distribution. Mt Yamizo (1022 m) lies in three prefectures: Fukushima, Ibaragi and Tochigi. A similar if not conspecific Yamanashi-ken specimen (14 / 2 / 2003) is 10 15 also in YNU collection although its caeca are slightly incised ventrally.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD0FF10FADFFB33A015.taxon	discussion	Remarks. The question of restoration from Easton’s (1981: 55) synonymy in A. micronarius mooted by Blakemore (2010 a: 193) is here supported.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.taxon	materials_examined	Material inspected. Holotype (H), NMST An 457, mature posterior amputee specimen fixed and stored in 80 % ethanol (EtOH), here dissected and figured (Fig. 10), from Hikone collected 2. II. 2011 by RJB and Shiga Uni. students. Paratype (P) NMST An 458, mature complete specimen with same collection details, in 80 % EtOH.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.taxon	etymology	Etymology. Japanese “ dragon eyes ”, for the appearance of the male pores. 146 JOURNAL OF SPECIES RESEARCH Vol. 1, No. 2 5 10 15 27 lhs 20 Metaphire ryunome 1 mm Fig. 10. Metaphire 18 lhs male pore of the paratype Diagnosis. Marginally in Metaphire with spermathecal pores 0.3 apart in 7 / 8 / 9. Genital markings small near or within spermathecal and male pores. Intestinal caeca simple, smooth from 27. Spermathecal diverticula elongate. Dorsal pores from 10 / 11.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.taxon	distribution	Distribution. Japan, Shiga-ken, Hikone (ca. 35 ̊ 16 ′ N 136 ̊ 16 ′ E), Kaideima-cho, from ‘ aze’ (dividing pathway) adjacently to rice paddy plots used by Shiga University.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.taxon	description	Description. Length 30 + mm (H) and 45 mm with 70 segments (P). Dorsum a faint brown colour with no mid-dorsal line, clitellum darker and ventrum pale. Dorsal pores from 10 / 11. Setae ca. 60 per segment. Spermathecal pores ca. 0.3 circumference apart in 7 / 8 / 9. Genital markings as small discs just posterior to spermathecal pores in papillae internal to eye-like secondary male pores on 18 just medi- an to primary male pore within small hollow construed as strictly non-superficial thereby just qualifying for Metaphire. Internally, small stalked glands correspond to the external genital markings. Peptonephridia to 5 / 6, septa after this thin, 8 / 9 present (at least ventrally) going to base of gizzard, 9 / 10 absent, 10 / 11 / 12 slightly thickened. Nephridia meroic forests. Spermathecae in 8 and 9 each having spherical ampulla on short duct with elongate diverticulum (inseminated). Dorsal vessel single; hearts in 10 - 13. Holandric, testis in sacs in 10 & 11; seminal vesicles anteriorly in 11 & 12. Ovaries fan-shaped with funnels in 13; no ovisacs in 14. Prostate racemose on long muscular ducts. Oesophagus not dilated; intestinal origin in 16 with simple, smooth caeca from 27. Typhlosole and gut contents not recorded. Parasites not found. mtDNA COI- 5 P Barcode result: Hikone Metaphire ryunome Holotype (H) An 457. BOLD Systems (www. boldsystems. org /) data for holotype tagged An 457.1 (compared to sub-samples An 457.2 and to paratype (P) An 458.1 and An 458.2 all initially tagged as “ Metaphire robustus ” from preliminary identification by RJB). AACTCTATACTTTATTTTAGGAATTTGAGCCGG AATAATCGGAGCTGGGATAAGCCTACTTATCCG CATTGAACTAAGTCAACCGGGGTCTTTCCTTGG AAGAGACCAGTTATATAATACGATTGTAACAGC ACATGCATTCCTCATAATTTTCTTCTTAGTAATA CCAGTATTTATTGGGGGGTTCGGAAACTGGTTG CTACCACTAATACTAGGAACACCAGATATAGCA TTCCCCCGACTAAATAACATAAGATTTTGACTA CTCCCCCCTTCCCTAATTCTCCTAGTGAGATCAG CTGCCGTAGAAAAAGGAGCAGGTACAGGTTGA ACAGTATACCCACCCCTAGCAAGAAATATAGC ACATGCGGGCCCCTCAGTAGATCTTGCAATCTT CTCACTACATTTAGCAGGTGCCTCGTCAATTTT AGGAGCTATTAATTTTATTACCACAGTGATCAA TATACGATGGTCAGGACTACGACTAGAACGAA TTCCATTATTTGTTTGAGCAGTAATAATTACTGT AGTACTACTACTATTATCACTCCCTGTACTAGC CGGTGCAATTACTATACTACTAACAGACCGAAA TCTTAACACATCCTTCTTTGATCCAGCTGGTGGT GGAGACCCAATTCTATACCAACACTTATTC BLASTn and megaBLAST analyses: An 457.1 vs. An 457.2 vs. An 458.1 vs. An 458.2 = 100 %, i. e. specimens same species. Sequence identity of An 457.1 with A. tralfamadore type is no better than 85 %, meaning they are different species. Results of megaBLAST of An 457.1 show that it is 99 % similar to “ Amynthas incongruus ” voucher EF 077552 from China; and is just 85 % identified with “ Amynthas tristriatus ” voucher EF 077538 from China, or with “ Amynthas robustus ” vouchers DQ 224191 and AB 542533 from Taiwan and Japan, respectively (i. e., similar to A. tralfamadore result).	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
0D1D878EFFE4FFD2FCBBF9BBFC47A5CF.taxon	discussion	Remarks. Although coming closest to the restricted definitions of either A. masatakae or A. robustus (Figs. 1 & 2) the most noticeable differences are lack of markings either mid-ventrally in 18 or paired near spermathecal and / or male pores, respectively. On the basis of the morphology differing from the types of A. robustus or A. masatakae, and because the mtDNA COI barcodes differ from what workers in Japan and Taiwan label as “ A. robustus ” (including masatakae?), these Hikone specimens are thus newly named. However, it is entirely possible that the COI vouchers from Japan and Taiwan represent some other valid or invalid synonyms of A. robustus as restored herein. Metaphire ryunome is morphologically comparable to Kobayashi’s (1937) Korean “ masatakae ” and to Pheretima reisuiensis Kobayashi, 1938: 139 from “ Zenra-nandô ” (= South Cholla) that too has spermathecal pores in 7 / 8 / 9; however, its anterior markings are more median in intersegmental furrows, amongst many other differences such as its dorsal pores from 11 / 12 and setae numbering 25 - 60. Kobayashi (1938) figures and describes “ Secondary male pore represented as a large eye-like aperture ” within which the primary male porophore is found. On the basis of this, it qualifies for genus Metaphire in a new combination as M. reisuiensis. Possibly both species are transitional from Amynthas Kinberg, 1867 to Metaphire Sims & Easton, 1972, the former having superficial male pores and often complex genital markings, the latter having non-superficial male pores often with intromittent organs in “ copulatory pouches ” of various depths thus having less need of genital markings to adhere, attach and help co-locate superficial pores of concopulants.	en	Blakemore, Robert J. (2012): New earthworm species from NIBR’s Jeju-do biosphere compared to historical and new Japanese types (Oligochaeta: Megadrilacea: Megascolecidae). Journal of Species Research 1 (2): 133-150, DOI: 10.12651/JSR.2012.1.2.133, URL: http://koreascience.or.kr/journal/view.jsp?kj=JOSRB5&py=2012&vnc=v1n2&sp=133
