identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
426A87ECFFDF7035925EFD6791DEFD68.text	426A87ECFFDF7035925EFD6791DEFD68.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Wolbachia Hertig 1936	<div><p>TESTING FOR WOLBACHIA INFECTION</p><p>We also tested our M. acerƲorum samples for Wolbachia infections in an attempt to explain the cause of parthenogenetic populations. For this, we extracted genomic DNA from the whole individual and we screened them for Wolbachia using the W-Spec diagnostic primers: W-spec f (5′– CATACCTATTCGAAGGGATAG–3′) / W-spec r (5′– AGCTTCGAG TGAAACCAATTC–3′) (Jeong et al., 2009) following the protocol implemented by Jeong et al. (2012).After the initial screening we genotyped the strains on three gene regions: ftsZ, aesp and 16S. In order to amplify the Wolbachia 16S rRNA gene we performed a nested PCR using an initial universal 16S rDNA primer set: 27f (5′–AGAGTTTGATCMTGGCTCAG–3′) / 1513r (5′–ACGGYTACCTTGTTACGACTT–3′) (Weisburg et al., 1991) and a second primer set: 76f (5′–TTGTAGCCTGCTATGGTATAAYT–3′) / 1012r (5′–GAATAGGTATRATTTYCATGT–3′) (O’Neill et al., 1992). The reaction protocol and PCR conditions were adapted from Jeong et al. (2012). The partial Wolbachia aesp gene for outer surface protein was obtained using the 81F (5′–TGGTCCAATAAGTGATGAAGAAAC–3′) / 691R (5′–AAAAATTAAACGCTACTCCA–3′) primer set (Zhou et al., 1998) following the PCR conditions from Vaishampayan et al. (2007). Finally, the ftsZ gene was amplified using the primers ftsZ_F1 (5′–ATYATGGARCATATAAARGATAG– 3′) / ftsZ_R1 (5′–TCRAGYAATGGATTRGATAT–3′) and the PCR protocol from Baldo et al. (2006).</p><p>PHYLOGENETIC ANALYSES</p><p>Sequences were aligned using MEGA 7 (Kumar et al., 2016). We also compared our COI sequences with those found in GenBank and BOLD databases (Supporting Information, Table S1). Pairwise genetic distances were estimated using the Kimura 2-parameter (K2P) nucleotide substitution model implemented in MEGA 7. Haplotype identities and diversity (h), as well as nucleotide diversity (Π) were determined using DnaSP v.5.1 (Librado &amp; Rozas, 2009). Haplotype networks were constructed using PopART v.1.7 (Leigh &amp; Bryant, 2015) with a medianjoining algorithm (Bandelt et al., 1999), in order to illustrate phylogenetic and geographic patterns. The best-fit model for nucleotide substitution, for each of the two mtDNA markers (16S and COI), was estimated using jModelTest v.2.1.5 (Guindon &amp; Gascuel, 2003; Darriba et al., 2012) with the Akaike information criterion (AIC). Also, the best partitioning scheme for the concatenated set was determined using PartitionFinder2 (Lanfear et al., 2016), both softwares were implemented on the CIPRES Science Gateway (Miller et al., 2010).</p><p>Phylogenetic trees were generated using the maximum likelihood (ML) and Bayesian inference (BI) methods. We used RAxML v.8 (Stamatakis, 2006) implemented online on the CIPRES Science Gateway for ML analyses, using 1000 bootstrap resampling and other parameters as default. Mr Bayes v.3.2 (Ronquist &amp; Huelsenbeck, 2003) was used for BI analyses. Two separate runs, with four Monte Carlo Markov chains were used with 10 × 106 generations with trees sampled every 1000 generations, the first 25% of samples being discarded as burn-in. BI posterior branch probabilities were calculated by the majority-rule consensus of the sampled trees and obtained tree diagrams were visualized using FigTree v.1.4.2 (Rambaut, 2014).</p><p>SEQUENCE- BASED SPECIES DELINEATION TESTS</p><p>In order to identify independent evolutionary units or operational taxonomic units (OTUs) in our datasets, we applied four DNA sequence-based species delineation approaches on our COI sequences as well as on concatenated sequences of COI and 16S. The COI gene was used for delimiting species in many taxonomic groups, providing evidence for independently evolving lineages and recognizing genetic patterns within groups, to support morphological evidence or other traditional taxonomic studies (Hamilton et al., 2014; Costa-Silva et al., 2015).</p><p>The first test is the statistical parsimony network analysis implemented in TCS v. 1.21 (Clement et al., 2000). The program computes the maximum number of mutations that constitutes a parsimonious connection between two haplotypes with a 95% probability and then reconstructs a network following the algorithms of Templeton et al. (1992). Each network is considered an OTU. The second test is the automatic barcode gap discovery (ABGD), implemented on the ABGD web platform (Puillandre et al., 2012). The principle of the test is that it uses the so-called ‘barcodegap’ in the distribution of the pairwise differences from the COI sequences to assign organisms into hypothetical species. The third test is the general mixed yule-coalescent model (GMYC) applied on another web-based server (https://species.h-its. org/gmyc/). The GMYC method is a likelihood method for delimiting species by fitting within- and between-species branching models to reconstructed gene trees (Fujisawa &amp; Barraclough, 2013). The fourth test is the Poisson Tree Process (PTP model). It is a model for delimiting species on a rooted phylogenetic tree, implemented also on an online platform (https://species.h-its.org/ptp/; Zhang, 2013; Zhang et al., 2013).</p></div>	https://treatment.plazi.org/id/426A87ECFFDF7035925EFD6791DEFD68	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
426A87ECFFD8703493E3FA269222FCEC.text	426A87ECFFD8703493E3FA269222FCEC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Myrmecophilus acervorum (Panzer 1799)	<div><p>MYRMECOPHILUS ACERVORUM (PANZER [1799])</p><p>One nymph, Bulgaria: Ludogorsko Plateau, Irihisar Reserve near Pobit Kamak village (43.6513°N, 26.6178°E, 288 m), 11.IV.2006, leg. N. Simov (IBEB); one nymph, Bulgaria: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.1535&amp;materialsCitation.latitude=41.7611" title="Search Plazi for locations around (long 23.1535/lat 41.7611)">Kresna Sheitan Dere</a> (41.7611°N 23.1535°E, 199 m), 12.V.2016, leg. I. Ș. Iorgu, D. Chobanov, L. A. Moscaliuc &amp; S. Borisov (MGAB) ; one nymph, Bulgaria: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.6218&amp;materialsCitation.latitude=41.5459" title="Search Plazi for locations around (long 23.6218/lat 41.5459)">Pirin</a> (41.5459°N 23.6218°E, 1673 m), 13.V.2016, leg. I. Ș. Iorgu, D. Chobanov, L. A. Moscaliuc &amp; S. Borisov (MGAB) ; 3 ♀♀, one nymph, Bulgaria: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.2679&amp;materialsCitation.latitude=41.4665" title="Search Plazi for locations around (long 23.2679/lat 41.4665)">Rupite</a> (41.4665°N 23.2679°E, 95 m, host ant Lasius sp.), 13.V.2016, leg. I. Ș. Iorgu, D. Chobanov, L. A. Moscaliuc &amp; S. Borisov (MGAB) ; 1 ♀, Germany: Baden-Württemberg, Graben-Neudorf, (49.15°N 8.5°E, 109 m, host ant Lasius sp., det. T. <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=8.5&amp;materialsCitation.latitude=49.15" title="Search Plazi for locations around (long 8.5/lat 49.15)">Stalling</a>), 12.X.2008, leg. T. Stalling (TS) ; 1 ♀, Germany: Baden-Württemberg, Holheim (48.8277°N 10.4486°E, 472 m, host ant Lasius flaƲus, det. T. <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=10.4486&amp;materialsCitation.latitude=48.8277" title="Search Plazi for locations around (long 10.4486/lat 48.8277)">Stalling</a>), 5.IV.2009, leg. T. Stalling (TS) ; 1 ♀, Hungary: Isaszeg, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=19.4208&amp;materialsCitation.latitude=47.5322" title="Search Plazi for locations around (long 19.4208/lat 47.5322)">Sikló valley</a> (47.5322°N 19.4208°E, 205 m), 9.II.2015, leg. A. Kotán, T. Németh &amp; V. Szénási (HNHM) ; 2 ♀♀, Hungary: Makád, flood basin of Danube, 10.IV.1993, leg. O. Merkl (HNHM) ; 2 ♀♀, Hungary: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=18.9&amp;materialsCitation.latitude=46.6" title="Search Plazi for locations around (long 18.9/lat 46.6)">Paks</a> (46.6 °N 18.9°E, 90 m), 25.V.2011, leg. D. Murányi (HNHM) ; 1 ♀, Romania: Arad county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.3517&amp;materialsCitation.latitude=45.9983" title="Search Plazi for locations around (long 22.3517/lat 45.9983)">Ilteu</a> (45.9983°N 22.3517°E, 162 m), 10.VI.2016, leg. I. Ş. Iorgu &amp; L. Fusu (MGAB) ; 1 ♀, Romania: Bacău county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.443&amp;materialsCitation.latitude=46.4261" title="Search Plazi for locations around (long 26.443/lat 46.4261)">Comăneşti</a> (46.4261°N 26.443°E, 408 m, host ant Lasius platythorax, det. I. Tăuşan), 12.VII.2013, leg. A. Pintilioaie (MGAB) ; one nymph, Romania: Bihor county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=21.9934&amp;materialsCitation.latitude=46.7737" title="Search Plazi for locations around (long 21.9934/lat 46.7737)">Rîpa</a> (46.7737°N 21.9934°E, 118 m), 24.IV.2014, leg. I. Ş. Iorgu &amp; E. I. Iorgu (MGAB) ; one nymph, Romania: Constanţa county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=28.448&amp;materialsCitation.latitude=43.8" title="Search Plazi for locations around (long 28.448/lat 43.8)">Hagieni</a> (43.8°N 28.448°E, 17 m, host ant Tetramorium cf. caespitum, det. I. Tăuşan), 16.V.2008, leg. L. A. Moscaliuc, I. Ş. Iorgu &amp; L. Fusu (LF) ; one nymph, Romania: Constanţa county, Constanţa (44.2177°N 28.6208°E, 7 m, Barber pitfall trap), VII.2014, leg. M. Skolka (MGAB); one nymph, Romania: Constanţa county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=27.9797&amp;materialsCitation.latitude=43.9891" title="Search Plazi for locations around (long 27.9797/lat 43.9891)">Dumbrăveni forest</a> (43.9891°N 27.9797 °E, 85 m, host ant Crematogaster sordidula, det. I. Tăuşan), 17.V.2008, leg. L. A. Moscaliuc, I. Ş. Iorgu &amp; L. Fusu (LF) ; 3 ♀♀, Romania: Hunedoara county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.8734&amp;materialsCitation.latitude=46.0328" title="Search Plazi for locations around (long 22.8734/lat 46.0328)">Băiţa</a> (46.0328°N 22.8734°E, 300 m), 31.VII.2016, leg. L. Moscaliuc (MGAB) ; 1 ♂, 1 ♀, Romania: Ialomiţa county, forest near Ialomiţa river, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.57&amp;materialsCitation.latitude=44.6975" title="Search Plazi for locations around (long 26.57/lat 44.6975)">Coşereni</a> (44.6975°N 26.57°E, 58 m, host ant Lasius platythorax, det. I. Tăuşan), 11.V.2013, leg. I. Ş. Iorgu &amp; E. I. Iorgu (MGAB) ; 2 ♂♂, 1 ♀, Romania: IaȘi county, forest near Siret river, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.7819&amp;materialsCitation.latitude=47.2105" title="Search Plazi for locations around (long 26.7819/lat 47.2105)">Paşcani</a> (47.2105°N 26.7819°E, 208 m, host ant Lasius platythorax, det. I. Tăuşan), 07.V.2013, leg. I. Ş. Iorgu &amp; E. I. Iorgu (MGAB) ; 5 ♂♂, 6 ♀♀, Romania: IaȘi county, forest near Siret river, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.782307&amp;materialsCitation.latitude=47.213688" title="Search Plazi for locations around (long 26.782307/lat 47.213688)">Paşcani</a> (47.213686°N, 26.782307°E, 207 m, host ant Lasius platythorax, det. I. Tăuşan), 01.V.2014, leg. I. Ş. Iorgu, (MGAB) ; 3 ♀♀, Romania: Mehedinţi county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=21.9053&amp;materialsCitation.latitude=44.9276" title="Search Plazi for locations around (long 21.9053/lat 44.9276)">Lăpuşnicu Mare</a> (44.9276°N 21.9053°E, 391 m, host ant Lasius platythorax, det. I. Tăuşan), 20.I.2015, leg. C. O. Manci (MGAB) ; 1 ♀, Romania: MureȘ county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=24.7684&amp;materialsCitation.latitude=46.2129" title="Search Plazi for locations around (long 24.7684/lat 46.2129)">Sighişoara</a> (46.2129°N 24.7684°E, 503 m), 22.V.2015, leg. L. Fusu (MGAB) ; 1 ♀, Romania: Neamţ county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.6244&amp;materialsCitation.latitude=46.7951" title="Search Plazi for locations around (long 26.6244/lat 46.7951)">Podoleni</a> (46.7951°N 26.6244°E, 245 m, host ant Lasius platythorax, det. I. Tăuşan), 20.VI.2020, leg. L. Fusu (MGAB) ; 3 ♀♀, Romania: TimiȘ county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.3269&amp;materialsCitation.latitude=45.8425" title="Search Plazi for locations around (long 22.3269/lat 45.8425)">Coşava</a> (45.8425°N 22.3269°E, 204 m, host ant Lasius platythorax, det. I. Tăuşan), 17.IV.2013, leg. I. Ş. Iorgu &amp; L. A. Moscaliuc (MGAB) ; 2 ♂♂, 1 ♀, Romania: Tulcea county, Letea forest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=29.5075&amp;materialsCitation.latitude=45.3055" title="Search Plazi for locations around (long 29.5075/lat 45.3055)">Danube Delta</a> (45.3055°N 29.5075°E, 7 m, host ant Tetramorium cf. caespitum, det. I. Tăuşan), 11.IX.2012, leg. I. Ş. Iorgu, R. M. J. C. Kleukers, B. Odé &amp; L. Willemse (MGAB) ; 1 ♂, 2 ♀♀, Romania: Tulcea county, Letea forest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=29.5222&amp;materialsCitation.latitude=45.2966" title="Search Plazi for locations around (long 29.5222/lat 45.2966)">Danube Delta</a> (45.2966°N 29.5222°E, 6 m, host ant Lasius platythorax, det. I. Tăuşan), 12. IV.2013, leg. I. Ş. Iorgu &amp; L. A. Moscaliuc (MGAB) ; 7 ♂♂, 5 ♀♀, Romania: Tulcea county, Letea forest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=29.53&amp;materialsCitation.latitude=45.3044" title="Search Plazi for locations around (long 29.53/lat 45.3044)">Danube Delta</a> (45.3044°N 29.53°E, 7 m, host ant Lasius platythorax, det. I. Tăuşan), 23.IX.2013, leg. I. Ş. Iorgu &amp; L. A. Moscaliuc (MGAB) ; 3 ♂♂, 3 ♀♀, Romania: Tulcea county, Letea forest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=29.53&amp;materialsCitation.latitude=45.3044" title="Search Plazi for locations around (long 29.53/lat 45.3044)">Danube Delta</a> (45.3044°N 29.53°E, 7 m, host ant Lasius platythorax, det. I. Tăuşan), 23.IX.2013, leg. I. Ş. Iorgu &amp; L. A. Moscaliuc (NBCN) ; 2 ♂♂, 3 ♀♀, Romania: Tulcea county, Letea forest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=29.53&amp;materialsCitation.latitude=45.3044" title="Search Plazi for locations around (long 29.53/lat 45.3044)">Danube Delta</a>, 45.3044°N 29.53°E, 7 m, host ant Lasius platythorax, det. I. Tăuşan), 23.IX.2013, leg. I. Ş. Iorgu &amp; L. A. Moscaliuc (TS) ; 2 ♂♂, 1 ♀, Romania: Vrancea county, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.5402&amp;materialsCitation.latitude=45.9902" title="Search Plazi for locations around (long 26.5402/lat 45.9902)">Lepşa</a> (45.9902°N 26.5402°E, 685 m, host ant Lasius platythorax, det. I. Tăuşan), 21.V.2013, leg. I. Ş. Iorgu (MGAB).</p></div>	https://treatment.plazi.org/id/426A87ECFFD8703493E3FA269222FCEC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
426A87ECFFD970349390FC2E918EFB2C.text	426A87ECFFD970349390FC2E918EFB2C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Myrmecophilus balcanicus STALLING 2013	<div><p>MYRMECOPHILUS BALCANICUS STALLING, 2013</p><p>Four ♂♂, 2 ♀♀, Bulgaria: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.1755&amp;materialsCitation.latitude=41.62" title="Search Plazi for locations around (long 23.1755/lat 41.62)">Mikrevo</a> (41.62°N 23.1755°E, 313 m, host ant Pheidole sp., det. I. Tăuşan), 12. V.2016, leg. I. Ș. Iorgu, D. Chobanov, L. A. Moscaliuc &amp; S. Borisov (MGAB); 1 ♂, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.37162&amp;materialsCitation.latitude=41.93676" title="Search Plazi for locations around (long 22.37162/lat 41.93676)">North</a> Macedonia: <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.37162&amp;materialsCitation.latitude=41.93676" title="Search Plazi for locations around (long 22.37162/lat 41.93676)">Osogovski Planini Mts</a>, St. Ilija Monastery above Beli vill. (41.93676°N 22.37162°E, 500 m, under stone), 5.IX.2009, leg. D. Chobanov (IBEB) .</p></div>	https://treatment.plazi.org/id/426A87ECFFD970349390FC2E918EFB2C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
426A87ECFFD9703493BDFB6390C5FAF7.text	426A87ECFFD9703493BDFB6390C5FAF7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Myrmecophilus fuscus STALLING 2013	<div><p>MYRMECOPHILUS FUSCUS STALLING, 2013</p><p><a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=2.372&amp;materialsCitation.latitude=42.5882" title="Search Plazi for locations around (long 2.372/lat 42.5882)">One</a> ♂, France: Villefranche-de-Conflent, Pyrénées- Orientales (42.5882°N 2.3720°E, 507 m, host ant Lasius sp., det. T. Stalling) 14.V.2013, leg. T. Stalling (TS) .</p></div>	https://treatment.plazi.org/id/426A87ECFFD9703493BDFB6390C5FAF7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
426A87ECFFD970349380FA0993F0FDC4.text	426A87ECFFD970349380FA0993F0FDC4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Myrmecophilus gallicus STALLING 2017	<div><p>MYRMECOPHILUS GALLICUS STALLING, 2017</p><p>Three ♀♀, three nymphs, France: Aubagne, Camping du Garlaban (43.297°N 5.536°E, 146 m), 11. V .2015, leg. T. Szentiványi (HNHM).</p><p>MYRMECOPHILUS NONVEILLERI INGRISCH &amp; PAVICÉVIĆ, 2008</p><p>One ♀, Bulgaria: Tsaparevo, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.09203&amp;materialsCitation.latitude=41.62545" title="Search Plazi for locations around (long 23.09203/lat 41.62545)">Maleshevska Mts.</a> (41.62545°N, 23.09203°E), 25.IX.2002, leg. S. Lazarov &amp; T . Ljubomirov (IBEB) ; 1 ♀, Bulgaria: Stargach Mt., Petrelik vill., 9. V .1998, leg. O. Ilieff, in coll. IBEB; one nymph Bulgaria, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=23.33852&amp;materialsCitation.latitude=43.450954" title="Search Plazi for locations around (long 23.33852/lat 43.450954)">Dolno Belotintsi</a> (43.450953°N 23.338521°E), 22.IV.2011, leg. D. Chobanov (IBEB) ; 1 ♂, Hungary: Budapest, leg. Szabó-Patay, labelled ‘ Myrmecophila acerƲorum Panz . ♂, det. Szabó-Patay’ (HNHM); 1 ♂, 1 ♀, two nymphs, Hungary: Budapest, leg. Szabó, labelled ‘ Myrmecophila acerƲorum Panz., det. Pongrácz’ (HNHM) ; 1 ♂, Hungary: Budapest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=19.006&amp;materialsCitation.latitude=47.547" title="Search Plazi for locations around (long 19.006/lat 47.547)">Hármashatár Hill</a> (47.547°N 19.006°E, 395 m, host ant: Formica gagates, det. A. Tartally), 1. V .1995, leg. A. Tartally (SG); 1 ♂, Hungary: Budapest, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=19.01&amp;materialsCitation.latitude=47.548" title="Search Plazi for locations around (long 19.01/lat 47.548)">Hármashatár Hill</a> (47.548°N 19.01°E, 387 m), 21.III.2015, leg. G. Puskás (HNHM) ; 1 ♀, Hungary: Buda Mt., Pilisborosjenő, Nagy-Kevély, 10. V .1954, leg. Z.Kaszab (in coll. HNHM); one nymph, Hungary: Mezőhegyes, ‘ <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=20.964&amp;materialsCitation.latitude=46.312" title="Search Plazi for locations around (long 20.964/lat 46.312)">Peregi-löszgyep’</a> (46.312°N 20.964°E, 97 m), 3. V .2013, leg. T. Deli (HNHM) .</p></div>	https://treatment.plazi.org/id/426A87ECFFD970349380FA0993F0FDC4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
426A87ECFFD97039903AFD619406FEF8.text	426A87ECFFD97039903AFD619406FEF8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Myrmecophilus acervorum (Panzer 1799)	<div><p>DESCRIPTION OF MYRMECOPHILUS ACERVORUM</p><p>Measurements</p><p>Adult male (N = 20): body length 2.5–2.7 mm; pronotum 0.6–0.7 mm long and 1.2–1.3 mm wide; hind femur 1.2–1.3 mm; hind tibia 1–1.1 mm; hind basitarsus 0.6– 0.7 mm; cerci 0.9–1 mm; subgenital plate 0.3 mm long and 0.5 mm wide.</p><p>Adult female (N = 22): body length 2.5–2.8 mm; pronotum 0.6–0.7 mm long and 1.2–1.3 mm wide; hind femur 1.2–1.3 mm; hind tibia 1–1.1 mm; hind basitarsus 0.6–0.7 mm; cerci 0.8–0.9 mm; subgenital plate 0.2 mm long and 0.3 mm wide; ovipositor 1.4–1.5 mm.</p><p>Length of hairs (both sexes): 30–40 µm on frons; 45–50 µm on antennae; 35–60 µm on pronotum and abdomen.</p><p>Description of male (Figs 1A, 2A, B, C, D, E, 3A, B)</p><p>Body slightly flattened dorsoventrally, weakly convex, 2.1–2.2 × as long as wide. Pronotum domeshaped, narrowed distally. Body and legs densely covered with a single type of hairs. The hairs are relatively short, shiny, and pointed, each with 26–35 costae.</p><p>Body colour reddish brown to dark reddish brown. Posterior margins of pronotum and mesonotum with a contrasting pale ochreous transversal band, and similar but less pronounced and narrower pale bands present on posterior margins of metanotum and tergites 1–3. Antenna about 1.1 × as long as body, dark ochreous, with massively inflated scape. Scape, pedicel, and apex of flagellum pale ochreous. Eyes dark grey or black. Palpi ochreous. Hind femur 1.5 × as long as wide; hind tibia with four subapical spurs on inner side. First segment of hind basitarsus with one dorsal spine in proximal third and two apical spurs. Epiproct small, with a slight, angular emargination, about 1.2–1.3 × as long as wide. Cercus round in transversal section, pointed apically, densely covered with hairs and sensilla. Phallic complex consists of a U-shaped epiphallus and a translucid ectophallus, with a pair of spiny, band-shaped apical sclerites. Subgenital plate distinctly emarginated.</p><p>Description of female (Figs 1B, 2F, 3C)</p><p>The appearance of the female, apart from the genital structures, largely corresponds to that of the male and it was comprehensively described and illustrated by Junker (1997), Schimmer (1909) and Stalling &amp; Birrer (2013).</p><p>COMPARATIVE DIAGNOSIS</p><p>Within the continental Balkans, M. acerƲorum can be distinguished from the other five co-occurring species, firstly, by the body colour. The characters discussed below hold both for the female and for the newly discovered male. For a more detailed analysis, the type of hairs, shape of female ovipositor and subgenital plate, and the hind basitarsus spines should be considered.</p><p>In M. acerƲorum, the body colour is reddish brown to dark reddish brown with contrasting, pale ochreous broad bands on the posterior third of the pronotum and posterior third of the mesonotum, and less pronounced and narrower pale bands on the posterior margins of metanotum and the first three abdominal tergites. Regarding coloration, Myrmecophilus balcanicus is pale brown with the following contrasting pale ochreous: posterior half of the pronotum, mesonotum completely, and the posterior margins of metanotum and the subsequent tergites. The coloration of Myrmecophilus nonƲeilleri is rusty brown with narrow, pale posterior borders on the pronotum or abdominal tergites; the coloration is uniformly dark brown in Myrmecophilus hirticaudus Fischer von Waldheim, 1846 and pale ochreous in Myrmecophilus myrmecophilus (Savi, 1819) with no ( M. hirticaudus) or only inconspicuous ( M. myrmecophilus) pale ochreous posterior border on the pronotum or abdominal tergites; Myrmecophilus ochraceus Fischer, 1853 is dark ochreous with rufousochreous pronotum, which is only slightly paler posteriorly. Beside the body colour, M. acerƲorum can be distinguished from the other Myrmecophilus species by its pilosity. In M. acerƲorum, the pronotum and tergites are densely covered with only one type of inclined, relatively short, shiny hairs. The arrangement of the hairs appears regular and the distance between them is almost as large as their length (Stalling &amp; Birrer, 2013). Myrmecophilus balcanicus has the pronotum and the tergites densely covered with much shorter, inclined, sparse hairs (Stalling, 2013c). Myrmecophilus myrmecophilus has the pronotum and the tergites densely covered with inclined, sparse, relatively long hairs, scrubby aligned. Two types of hairs cover the body of M. hirticaudus: few prominent hairs and many short, close-fitting hairs. In M. ochraceus, the pronotum and tergites are densely covered with short, inclined, hairs, and the hairs on the frons and antennae are unlike those in all other species, being long, sparse and bushy. The shape of female subgenital plate can also be used when separating some ant cricket species. The females of M. myrmecophilus and M. ochraceus have a rounded or distally slightly emarginated subgenital plate, whereas M. acerƲorum, M. balcanicus and M. hirticaudus have distinctly emarginated subgenital plates. In M.nonƲeilleri the apex is slightly emarginated or truncate (Stalling, 2013c; Stalling &amp; Birrer, 2013).</p><p>Previously considered as the main identification traits for Myrmecophilus (Bacetti, 1966; Harz, 1969), the number and position of the spines on the hind basitarsus seem to be highly variable in several species. For example, in the Central European and North Mediterranean species of the genus, only M. hirticaudus has three dorsal spines, positioned on the proximal, medial and distal parts of the hind basitarsus. Two or three spines variably occur in M. myrmecophilus, the distal one being usually absent, while in M. acerƲorum and M. aequispina the distal spines are always absent (Stalling &amp; Birrer, 2013). The continental Balkan species can be grouped as follows: basitarsus of the hindleg with a single spine in the proximal third ( M. ochraceus), hind basitarsus with two dorsal spines in proximal and median positions ( M. acerƲorum, M. balcanicus, M. myrmecophilus), hind basitarsus with two or three spines ( M. nonƲeilleri) and hind basitarsus with a constant number of three dorsal spines, positioned in the proximal, median and distal parts ( M. hirticaudus) (Stalling &amp; Birrer, 2013).</p><p>SEQUENCE CHARACTERISTICS</p><p>We obtained a total of 93 sequences (52 for COI and 41 for 16S), from 42 individuals of M. acerƲorum and from 11 other Myrmecophilus individuals used as outgroup and in species delineation analyses (Supporting Information, Table S1). We obtained a final concatenated alignment of 1183 bp with 937 constant sites and 239 variable sites out of which 185 are parsimony informative (Table 1). We identified a total of 19 haplotypes, ten for the ingroup and nine for the outgroup (Supporting Information, Table S1). In the ingroup, we identified 18 polymorphic sites out of which only three were parsimony informative. Nucleotide model of evolution for the concatenated set of data was determined as GTR with gamma distributed rate differences among sites (Table 1). Genetic differentiation between nominal species of Myrmecophilus varied between 2.66 % and 18.53% (Table 2), while the mean intraspecific distance varied from 0.24% to 0.91%.</p></div>	https://treatment.plazi.org/id/426A87ECFFD97039903AFD619406FEF8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Iorgu, Ionuț Ştefan;Iorgu, Elena Iulia;Stalling, Thomas;Puskás, Gellért;Chobanov, Dragan;Szövényi, Gergely;Moscaliuc, Liviu Aurel;Motoc, Rozalia;Tăuşan, Ioan;Fusu, Lucian	Iorgu, Ionuț Ştefan, Iorgu, Elena Iulia, Stalling, Thomas, Puskás, Gellért, Chobanov, Dragan, Szövényi, Gergely, Moscaliuc, Liviu Aurel, Motoc, Rozalia, Tăuşan, Ioan, Fusu, Lucian (2023): Ant crickets and their secrets: Myrmecophilus acerŋorum is not always parthenogenetic (Insecta: Orthoptera: Myrmecophilidae). Zoological Journal of the Linnean Society 197 (1): 211-228, DOI: 10.1093/zoolinnean/zlab084, URL: https://academic.oup.com/zoolinnean/article/197/1/211/6413619
