identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
C21187BFCD562A3BFF79FBC84A21F85C.text	C21187BFCD562A3BFF79FBC84A21F85C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Anarta (Tricholea) insolita subsp. umay Volynkin, Titov & Cernila 2020	<div><p>Anarta (Tricholea) insolita umay Volynkin, Titov &amp; Černila, ssp. n.</p> <p>(Figs 1–4, 9, 10, 13, 15)</p> <p>Type material. Holotype (Figs 1, 9): male, “ 04.VI.2010, Russia, Altai Republic, Kosh- Agach District, foot of Kuraisky Ridge near <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=88.42592&amp;materialsCitation.latitude=50.094948" title="Search Plazi for locations around (long 88.42592/lat 50.094948)">Chuya Steppe</a>, 5 km E of Chagan-Uzun village, stony steppe, 50°5'41.82"N 88°25'33.32"E, 2130 m. Volynkin A. V. leg.”, genital slide AV0842 Volynkin (Coll. ZSM, ex coll. CAV).</p> <p>Paratypes: RUSSIA: 2 males, same data as for the holotype (Coll. CAV); 4 males, Russian fed., Altai mtns., Kosh-Agach distr., <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=88.426384&amp;materialsCitation.latitude=50.095833" title="Search Plazi for locations around (long 88.426384/lat 50.095833)">Chagan-Uzun</a>, 10.station, 2280 m a.s.l., 050°05'45"N, 088°25'35"E, Černila M. (Coll. MCK); 1 male, Russian fed., Altai mtns., Kosh-Agach distr., <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=89.079445&amp;materialsCitation.latitude=49.67861" title="Search Plazi for locations around (long 89.079445/lat 49.67861)">Ulandryk</a> r., 2050m a.s.l., 049°40'43"N, 089°04'46"E, 21–22. VI.2011, Černila M., Nakonechny A.N. (Coll. MCK); 1 male, 12.VII.2009, Altai Republic, Kosh-Agach district, Chuya steppe, 6 km SE of Chagan-Uzun village, steppe. 1800m. N 50º04', E 88º24' By light. Volynkin A. V., Černila M. &amp; Nakonechnyi A.N. leg. (Coll. CAV); MONGOLIA: 3 females, Bayan-Ölgii aimak, NE coast of Tolbo Nuur Lake, 2100m, 1.VII.1968, exp. Kaszab (Coll. HNHM); 1 female, Bayanchongor aimak, Mts., <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=100.21667&amp;materialsCitation.latitude=45.0" title="Search Plazi for locations around (long 100.21667/lat 45.0)">Ih Bogd Uul</a>, 1850 m, valley of <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=100.21667&amp;materialsCitation.latitude=45.0" title="Search Plazi for locations around (long 100.21667/lat 45.0)">Pitut river</a>, 45°00’ N, 100°13’ E, 24- 26.VII.1987, leg. L. Peregovits, M. Hreblay, &amp; T. Stéger (Coll. PGM); 1 female, Dundgovi aimak, 22 km S of Mandalgovi, 8. V.1990, leg. Fábián, Hreblay, Peregovits &amp; Ronkay (Coll. GRB); 1 male, Dundgovi aimak, Mandalgovi, leg. Varga, genital slide 5936 Varga (Coll. ZVD); 1 male, Ömnögovi aimak, Naran Bulag, 1500m, 14. V.1990, leg. Fábián, Hreblay, Peregovits &amp; Ronkay, genital slide 9937 Hacker (Coll. HNHM); 1 female, Ömnögovi aimak, Gurvantos, 1300m, 12–14. V.1990, leg. Fábián, Hreblay, Peregovits &amp; Ronkay, genital slide 9938 Hacker (Coll. HNHM) (former paratypes of A. i. uigurica); 1 male, 1 female, 30– 31.05.2011, SW Mongolia, Govi-Altai aimak, Mongolian Altai Mts. (S. slope), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=93.78333&amp;materialsCitation.latitude=45.65" title="Search Plazi for locations around (long 93.78333/lat 45.65)">Mogoijn-Gol valley</a>, h= 1800 m, 45°39’ N, 93°47’ E. Yakovlev R. V. leg., genital slide AV1480 (female) Volynkin (Coll. CAV); 2 males, 06– 08.07.2010, SW Mongolia, Govi-Altai aimak, Mongolian Altai Mts. (S slope), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=93.78333&amp;materialsCitation.latitude=45.65" title="Search Plazi for locations around (long 93.78333/lat 45.65)">Mogoijn-Gol Valley</a>, 1800m, 45º39' N, 93º47' E, Yakovlev R. V. &amp; Guskova E. V. leg., genital slide AV0893 Volynkin (Coll. CAV); 1 female, 29.05.2011, W Mongolia, Khovd aimak, near of Altan-Soembo, <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=93.35&amp;materialsCitation.latitude=45.65" title="Search Plazi for locations around (long 93.35/lat 45.65)">Uvchugijn-Serven Mt.</a>, 1700m, 45°39’N, 93°21’E. Yakovlev R. V. leg. (Coll. CAV); 1 female, 19.06.2005, W Mongolia, Khovd aimak, Bodonchijn-Gol river basin, Tsagduultai river valley, 2000 m, Yakovlev R. V. leg. (Coll. CAV).</p> <p>Diagnosis. The new subspecies differs externally from A. i. uigurica in its less contrast forewing pattern, paler claviform stigma, slightly narrower and more monotonous reniform stigma, narrower and more interrupted inner blackish brown shade of the subterminal line, and narrower and more diffuse discal spot of hindwing. In comparison to the nominate subspecies (Fig. 8), A. i. umay ssp. n. has the slightly smaller size and narrower forewing with a less elongate apex, the ochreous brown forewing coloration (sand yellowish in A. i. insolita), the conspicuously more contrast forewing pattern with a well-developed subterminal line, the smaller orbicular stigma with a clearly distinguishable fringe (that is indistinct in A. i. insolita), the narrower reniform stigma with a clearly distinguishable fringe and a dark grey suffusion in its posterior half (in A. i. insolita that is monotonous with an indistinct fringe), and the broader discal spot of hindwing. The male genitalia of A. i. umay ssp. n. are very similar to those of A. i. uigurica (illustrated by Hacker (1998)), but in A. i. umay ssp. n. the right saccular process is slightly less elongate, whereas in A. i. insolita that is more elongate and reaches the tip of cucullus. The male genitalia of A. i. umay ssp. n. differ clearly from those of A. i. uigurica in the narrower uncus, the more elongate and more heavily sclerotized juxta, the narrower right saccular process with a pointed tip (whereas in A. i. uigurica the right saccular process is more robust and apically broadened and densely dentate), and the slightly larger cornutus in aedeagus vesica. The female genitalia of the three subspecies are very similar, but those of A. i. umay ssp. n. have the slightly shorter apophyses anteriores and slightly more heavily sclerotized longitudinal ribs of the posterior section of corpus bursae than those structures of A. i. uigurica. Additionally, the anterior section of corpus bursae of the new subspecies bears a narrowly lanceolate, weakly sclerotized signum, which is absent in A. i. uigurica. The distal female abdominal segments of A. i. umay ssp. n. (Fig. 15) are narrower than those of A. i. uigurica (Fig. 16). Compared to the nominate subspecies (illustrated by Hacker (1998)), the female genitalia of A. i. umay ssp. n. have the slightly less elongate and more weakly sclerotized longitudinal ribs of the posterior section of corpus bursae.</p> <p>Description. External morphology of adults (Figs 1–4). Forewing length 14–17 mm in males and 16–17 mm in females. Male antenna ciliate, female antenna filiform. Body ochreous brown with slight admixture of dark brown scales. Forewing moderately broad, triangular. Forewing ground color ochreous brown with slight admixture of dark brown scales. Basal line double, brown but blackish on costa, wavy, interrupted on veins. Antemedial line double, brown but blackish on costa, irregularly wavy. Claviform stigma short, with rounded tip, pale brown, sometimes indistinct. Orbicular stigma round, pale ochreous, fringed with brown scales. Reniform stigma moderately large, with concave outer margin, fringed with brown scales, its anterior half pale ochreous, while posterior one with strong grey suffusion. Postmedial line double, brown but blackish on costa, its inner line irregularly wavy, while outer one irregularly dentate. Subterminal line dark brown, irregularly dentate, its posterior half indistinct between veins, while anterior one fringed with blackish brown shades inwardly. Terminal line thin, blackish brown, interrupted between veins. Outer wing margin slightly wavy, cilia pale ochreous. Hindwing pale ochreous with brown suffusion basally and medially, and brown in outer third. Discal spot large, semilunar. Cilia pale ochreous. Male genitalia (Figs 9, 10). Uncus broad, dorso-ventrally flattened, elliptical, with narrow base, densely setose ventrally. Tegumen short, penicular lobe broad, rounded. Juxta elongate and narrow, curved medially, heavily sclerotized. Vinculum short but robust, V-shaped with rounded tip. Valva elongate, moderately broad, with narrow cucullus with rounded tip; corona presented. Costa narrow but heavily sclerotized, with short, broad, rounded and swollen extension directed distally-ventrally. Sacculi large, strongly asymmetrical: left one very short with broad and rounded tip, while right one with long, distally narrowed and apically pointed and weakly dentate, completely covers clasper. Clasper nearly straight with slightly convex outer margin, parallel the ventral margin of valva, distally foot-like broadened. Aedeagus elongate, with large coecum, slightly curved medially and narrowed distally. Vesica with short semiglobular subbasal dorsal diverticulum and elongate, medially curved and distally strongly narrowed distal diverticulum bearing small spine-like apical cornutus; vesica ejaculatorius moderately broad, originates subbasally, directed ventrally. Female genitalia (Fig. 13). Ovipositor short, broad, conical; papilla analis trapezoid with rounded corners, densely setose. Apophyses thin, apophyses posteriores ca. twice longer than apophyses anteriores. Ostium bursae moderately broad, with medial concavity ventrally. Ductus bursae short, heavily sclerotised, dorso-ventrally flattened. Posterior section of corpus bursae narrow and elongate, with numerous longitudinal sclerotized ribs. Anterior section of corpus bursae pear-shaped, membranous, with narrowly lanceolate weakly sclerotized signum. Appendix bursae very short and moderately broad, rugose, situated latero-ventrally at junction to ductus bursae.</p> <p>Molecular data. COI 5‘ sequences of two specimens of A. i. umay ssp. n. from Western Mongolia (Mogoijn-Gol valley, BOLD vouchers BC ZSM Lep 90261 and 90262) were compared with COI 5‘ sequences of two specimens of A. i. uigurica (BOLD vouchers BC ZSM Lep 90263 and 90264). The COI 5‘ sequences of the two subspecies have no diagnostic differences. The 658 b. p. length COI 5‘ sequence of the A. i. umay ssp. n. paratype (BOLD voucher BC ZSM Lep 90263) is as follows: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTC GAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTAC AGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTG ACTTGTCCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAACAATATAAGTTTTT GACTCTTACCCCCATCTCTAACTCTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAAC AGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATTTA GCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACA ATTATCAATATACGATTAAATAGTTTATCCTTTGATCAAATACCTTTATTTATTTGAGCTGTAGG AATTACCGCATTTTTATTATTATTATCACTTCCTGTATTAGCTGGAGCTATTACTATACTTTTAAC TGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGTGGAGGTGACCCAATTTTATATCAAC ATTTATTT.</p> <p>Distribution. The new subspecies is known from the southeastern part of the Russian Altai Mts (Kosh-Agach District: Chuya Steppe), and western and southern Mongolia (Bayan-Ölgii, Khovd, Govi-Altai, Dundgovi and Ömnögovi Aimags).</p> <p>Etymology. In Turkic mythology, Umay is the goddess of fertility and the patroness of children.</p></div> 	https://treatment.plazi.org/id/C21187BFCD562A3BFF79FBC84A21F85C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Volynkin, Anton V.;Titov, Sergey V.;Černila, Matjaž	Volynkin, Anton V., Titov, Sergey V., Černila, Matjaž (2020): Anarta insolita umay, a new subspecies from Russian Altai and Mongolia, with re-characterization of Anarta insolita uigurica (Hacker, 1998) (Lepidoptera, Noctuidae, Noctuinae). Ecologica Montenegrina 35: 115-122, DOI: 10.37828/em.2020.35.8, URL: http://dx.doi.org/10.37828/em.2020.35.8
C21187BFCD512A38FF79FF5F4E0EF97A.text	C21187BFCD512A38FF79FF5F4E0EF97A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Anarta (Tricholea) insolita subsp. uigurica (Hacker 1998)	<div><p>Anarta (Tricholea) insolita uigurica (Hacker, 1998)</p> <p>(Figs 5–7, 11, 12, 14, 16)</p> <p>Hadula insolita uigurica Hacker, 1998, Esperiana 6: 599, Plate Hadula I, fig. 5 (Type locality: [East Kazakhstan Region, Kurchum District, near Kaiyndy Village, Narym Ridge] “ Kasachstan, Süd- Altaij, Slavianka, Narym-Gebirge, 420m, 48°51’N 83°32’E ”).</p> <p>Type material examined: photographs of the holotype (Fig. 7), female, dark green label “ Kasachstan, Süd- <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=83.53333&amp;materialsCitation.latitude=48.85" title="Search Plazi for locations around (long 83.53333/lat 48.85)">Altaij</a>, Slavianka, Narym-Gebirge, 420m, 48°51’N 83°32’E, 1993. V.26. Leg.: V. &amp; A. Lukhtanov | Dr. P. Gyulai, Hungary ” / red label “HT” / red label “ Hadula -Revision, ESPERIANA VI (1998), Hadula insolita ssp. uigurica Hacker, Holotypus ” / yellow label “Gen. Präp [genital slide] Hacker N 10509” (Coll. PGM, later to be deposited in HNHM).</p> <p>Additional material examined. 7 males, 4 females, 06. V.2015, E Kazakhstan, Kurchum District, 15.5 km NNE of Amanat village, Kiin-Kirish Massif, clay/chalk hills, 447m, N 48°7.885’ E 84°29.378’, Volynkin A. V. &amp; Titov S. V. leg., genital slides AV1465, AV1478 (males), AV1477, AV1479 (females) Volynkin (Coll. CAV).</p> <p>Diagnosis. Forewing length is 14–16 mm in males and 14–17 mm in females. Anarta insolita uigurica can be distinguished from the two other subspecies by its more contrast pattern and more distinct reniform and orbicular stigmata. The male genitalia of A. insolita uigurica differ clearly from the two other subspecies by the broader uncus, the slightly broader cucullus, and the right saccular process being robust and apically broadened and densely dentate (whereas in A. i. insolita and A. i. umay ssp. n. that is distally narrowed, apically pointed and weakly dentate apically). The female genitalia of A. i. uigurica differ from those of A. i. insolita and A. i. umay ssp. n. in the shortest and most weakly sclerotized longitudinal ribs of the posterior section of corpus bursae and the absence of signum bursae (present in the two other subspecies). The detailed comparison with A. i. umay ssp. n. is provided above in the ‘Diagnosis’ chapter of the latter.</p> <p>Molecular data. The COI 5‘ sequences of two specimens of A. i. uigurica (BOLD vouchers BC ZSM Lep 90263 and 90264) display variability in loci 444 (C/T), 612 (C/T) and 636 (A/G). The 658 b. p. length COI 5‘ sequence of the A. i. uigurica (BOLD voucher BC ZSM Lep 90263) is as follows: AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAG ATTATTAATTC GAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTAC AGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTG ACTTGTCCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAACAATATAAGTTTTT GACTCTTACCCCCATCTCTAACTCTTTTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAAC AGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCAGTAGATTTA GCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTCTTGGAGCTATTAATTTTATTACTACA ATTATCAATATACGATTAAATAGTTTATCCTTTGATCAAATACCTTTATTTATTTGAGCTGTAGG AATTACCGCATTTTTATTATTATTATCACTTCCTGTATTAGCTGGAGCTATTACTATACTTTTAAC TGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGTGGAGGTGACCCAATTTTATATCAAC ATTTATTT</p> <p>Distribution. The subspecies is known up to date from two localities in the Kurchum District of the East Kazakhstan Region (western Kazakh Altai Mts and its foothills). The status of the population from SE Kazakhstan (Altyn Emel National Park, the record was based on a single female) (Hacker 1998) needs clarification.</p></div> 	https://treatment.plazi.org/id/C21187BFCD512A38FF79FF5F4E0EF97A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Volynkin, Anton V.;Titov, Sergey V.;Černila, Matjaž	Volynkin, Anton V., Titov, Sergey V., Černila, Matjaž (2020): Anarta insolita umay, a new subspecies from Russian Altai and Mongolia, with re-characterization of Anarta insolita uigurica (Hacker, 1998) (Lepidoptera, Noctuidae, Noctuinae). Ecologica Montenegrina 35: 115-122, DOI: 10.37828/em.2020.35.8, URL: http://dx.doi.org/10.37828/em.2020.35.8
