Leurus jesusugaldei Zuñiga & Valerio, sp. nov.

(Figs. 10, 13)

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.3 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape brownish dorsally but lighter colored ventrally, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibiae pale yellow basally, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.

Male: Unknown

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0045043. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 11-SRNP-2363. Database information: Costa Rica, ACG, Alajuela Prov., Sector San Cristobal, Finca San Gabriel, 10.87766, -85.39343, 645m (Elda Araya) Diacme BioLep 02 ( Crambidae) caterpillar feeding on Thelypteris nicaraguensis ( Thelypteridaceae), coll. 21.vi.2011 wasp eclosed 17.vii.2011 . Paratypes. 1 ♀, (MNCR), COSTA RICA, ACG database code: 10-SRNP-44944: DHJPAR0041070 (♀).

Barcode. DNA barcode of female holotype DHAJPAR0045043 (658 bp):

GATTCTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGTGCCTCTTTAAGTATTATTATTCG AATAGAACTAGGGACCCCCGGAGCTCTAATTAACAACGATCAAATTTACAATTCTATTGTAACTATAC ATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTACCCCTTT AATATTAGGGGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGTTATTACCTCC ATCATTATTCTTATTAATTTCTGGAAGAATCTTAAATCAAGGGGCAGGGACTGGTTGAACAGTTTACCCTCCTTT ATCATCTAATATTAATCATGAAGGACTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCTGGT ATTCCTCAATTATAGGGGCAATCAATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTGGCCTT AGACCAACTTTCTTTATTTATCTGATCTATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTG TTTTAGCGGGGGCAATCACTATATTATTAACTGATCGTAATTTAAATACTTCTTTTTTTGACCCAAGTGG AGGGGGGGACCCAATTTTATACCAACACTTA

Etymology. This species is named in recognition of Jesus Ugalde, formerly of the Instituto Nacional de Biodiversidad (INBio) of Costa Rica, in recognition of his many years of Hymenoptera curation and administration of the national biodiversity inventory.

Comments. Like L. hugokonsi and L. sondrawardae, L. jesusugaldei has metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, and hind tarsomeres 1–2 with dark apices. However, L. jesusugaldei differs by having slightly more white at the base of the hind tibia, extending about 4.0 × length of tibia (as opposed to no more than 3.0 × length of tibia). It can also be distinguished by its barcode and hosts, being the only Leurus species parasitizing a fern-feeding caterpillar.

Hosts. Leurus jesusugaldei appears to occur at a very low density, with just two reared specimens; however, the inventory has only been able to rear 173 of its distinctive fern-feeding crambid caterpillars, Diacme biolep 02. Both caterpillars were feeding on Thelypteris nicaraguensis, but the sample size is not large enough to hazard a guess as to whether the wasp is also specialized on this particular plant, of the many species of ferns utilized by Diacme Solis 02.