Leurus maryjanewestae Zuñiga & Valerio, sp. nov.

Diagnositc description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.2 mm). Malar space 0.7−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape pale yellow to brownish, pedicel yellowish to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence. Trochanters pale to light brown; fore and mid femora predominantly black, hind femora entirely black; fore and mid tibiae pale yellow to orangish, hind tibia predominantly white, black apically; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.

Male: Unknown.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0052171. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 13- SRNP-2266. Database information: Costa Rica, ACG, Guanacaste Prov., Sector San Cristobal, Sendero Palo Alto, 10.88186, -85.3822, 570m (Carolina Cano), Rhectocraspeda periusalis ( Crambidae) caterpillar feeding on Piper sancti-felicis ( Piperaceae), coll. 30.x.2013. wasp eclosed 18.xi.2013 . Paratypes. 6 ♀, (EMUS, MNCR). COSTA RICA, ACG database codes: 10-SRNP-44150: DHJPAR0041461 (♀); 09-SRNP-5377: DHJPAR0038423 (♀); 02- SRNP-6303: DHJPAR0014020 (♀); 02-SRNP-1978: DHJPAR0014012 (♀); 12-SRNP-1713: DHJPAR0048898 (♀); 13-SRNP-69202: DHJPAR0051726 (♀).

Barcode. DNA barcode of female holotype DHJPAR0052171 (658 bp):

AATTTTATACTTCATTTTTGGAATTTGGGCAGGAATAATTGGTGCTTCACTTAGTATTATTATCCG AATAGAATTAGGAACCCCCAGTTCCTTAATTAATAATGACCAAATTTATAATTCTATTGTCACTATACATGCCTTT ATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATTGACTTAATCCTTTAATATTAGG AGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTCTGATTATTACCCCCATCCTTATTTTTATTAA TTTCTGGTAGAATCTTAAATCAAGGGGCAGGAACTGGTTGAACAGTTTACCCTCCATTGTCTTCTAATACAAATC ATGAAGGATTATCAGTTGATTTAAGAATCTTCTCTCTCCATTTAGCTGGAATATCTTCAATTATAGGAGCAATT AACTTTATCACAACTATTTTAAATATAANAATTAAATTATTAACTTTAGATCAACTTTCATTATTTATTTGATCC ATTAAAATTACTACTATTTTACTTTTATTAGCAGTCCCTGTTTTAGCAGGAGCAATCACCATATTATTAACTG ACCGTAACTTAAATACCTCTTTTTTTGACCCTAGAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Etymology. This species is dedicated to Mary Jane West-Eberhard, in recogntion of her decades of research on the evolution of insects and their social behavior, with special emphasis on Hymenoptera .

Comments. Leurus maryjanewestae is morphologically indistinguishable from Leurus billeberhardi at the level of examination currently possible, and parasitizes the same species of caterpillar feeding on the same species of shrub (Table 1) in the same rain forest, but the two species have very different DNA barcodes (Fig. 2).

Hosts. This species has been reared seven times from a sample of 490 caterpillars of Rhectocraspeda periusalis collected in the wild between 1997 and 2013.