Leurus sondrawardae Zuñiga & Valerio, sp. nov.

(Fig. 11)

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.2 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape brown, pedicel brown, flagellum brownish; tegula predominantly black, light yellow anteriorly; metasoma black, with metallic blue iridescence or completely black. Trochanters pale to light brown; fore femora pale to light orange, hind femora entirely black; fore tibia pale yellow to brownish, mid and hind tibiae entirely black; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus pale with all dark apices dark.

Male: Unknown.

Material. Holotype. ♀. Deposited at EMUS. 1. DHJPAR0036739. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 09-SRNP-42662. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest, Quebrada Escondida, 10.89928, -85.27486, 420m (Anabelle Cordoba), Piletosoma thialis ( Crambidae) caterpillar feeding on Doliocarpus multiflorus ( Dilleniaceae) coll. 22.ix.2009, wasp eclosed 19.x.2009. Paratypes. 2 ♀, (EMUS, MNCR). COSTA RICA, ACG database codes: 02-SRNP-720715, DHJPAR0014016 (♀); 09-SRNP-42108, DHJPAR0036732 (♀).

Barcode. DNA barcode of female holotype DHJPAR0036739 (636 bp):

GGCCCTTTACTTTATTTTTGGCATTTGAGCTGGAATAATTGGAACCTCTCTAAGAATCATTATTCG AATAGAATTAGGAACCCCCGGCTCTTTAATTAATAATGACCAAATTTATAATTCTATCGTCACTATAC ATGCCTTTATCATAATTTTTTTTATAGTAATACCAATTATGATTGGGGGATTTGGTAATTGACTTGCTCCATT AATATTGGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATC ATTATTCTTATTAATTTCAGGAAGAATCCTAAATCAAGGGGCCGGAACTGGATGAACAGTATATCCACCTTTATC ATCTAATACTAATCATGAAGGATTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCAGGCATGTCCTCAATT ATAGGGGCAATCAACTTCATTACAACTATTTTTAATATAAAAATTAAATTATTAACTTTAGACCAACTTTCATT ATTTATTTGATCTATTAAAATTACTACTATTCTTCTACTACTTGCAGTCCCTGTTTTAGCAGGGGCAATCACT ATATTATTAACAGATCGTAACTTAAA TACCTCTTTTTTTGACCCAAGAGGGGGCGGAGACCC

Etymology: This species is named in honor of the late Sondra Ward, formerly of the Natural History Museum in London, for her invaluable assistance in the study of Ichneumonidae .

Comments. We were unable to distinguish L. sondrawardae morphologically from L. hugokonsi . Both species have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3.0 × length of tibia. However, L. sondrawardae has a very distinctive and different DNA barcode, and it parasitizes a very different species of caterpillar feeding on a different family of host plants.

Hosts. Leurus sondrawardae has been reared from Piletosoma thialis Dyar ( Crambidae) feeding on the rainforest liana, Doliocarpus multiflorus ( Dilleniaceae). No other species of the L. caeruliventris complex in ACG utilizes this caterpillar genus or this host plant family.