Rogas shimborii Quicke & Sharkey sp. nov.
Type material.
Holotype. Costa Rica • ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, Pailas Dos, 10.76 ° N, 85.334 ° W, 809 m, 2. viii. 2018, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap PL 12-9); CNC (Specimen voucher: BIOUG 58035-F 04; BIN BOLD: AEF 7075) . Paratype: Costa Rica • 1 ♀; Area de Conservación Guanacaste, Guanacaste Province, Sector Pailas, Pailas Dos, 10.764 ° N, 85.333 ° W, 853 m, 25. vi. 2020, leg. D. Janzen, W. Hallwachs, ecotone between lowland tropical dry forest and intermediate elevation rain forest, Malaise trap (PL 12-6); CNC. (Specimen voucher: BIOUG 63902-A 02; BIN BOLD: AEF 707) .
Diagnostics.
BOLD: AEF 7075. Consensus barcode: TTTATATTTTTTATTTGGTATTTGAGCGGGGCTTTTAGGGCTATCTATAAGGTTAATTATTCGGTTAGAATTAAGTATACCTGGGAGGTTATTAGGTAATGATCAGATTTATAATGGAATAGTAACTGCACATGCATTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATGGCTTTCCCTCGTATAAATAATATAAGATTTTGATTGTTAATTCCGTCATTAATTTTATTATTATTAAGAGCTATTGTAAATGTAGGGGTTGGTACAGGTTGAACAATTTATCCTCCTTTATCTTCTTTAATAGGGCATGGAGGGATATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATCTCTTCTATTATAGGGGTTGTAAATTTTATTTCTACAATTTTTAATATAAAGTTAATTTCTATTAGTCTAGATCAGATTAATTTATTTGTATGGTCTGTTTTAATTACTGCTATTTTATTATTATTATCTTTACCTGTATTAGCGGGGGCCATTACAATATTATTAACAGATCGTAATTTAAATACAACTTTTTTTGATTTTTCAGGGGGGGGGGATCCTGTTTTATTTCAACATTTATTT
The new species may be distinguished from all other described species by its bicolorous (black and ivory-white metasoma (Fig. 1 A, B); these are reddish-yellow, ochreous-yellow or brown in R. luteus, R. oyeyamensis (Watanabe, 1937), R. roxana (Telenga, 1941), R. nigrovenosus (Vojnovskaja-Krieger, 1935), R. nigristigma Chen & He, and R. flavus Chen & He, 1997 largely uniformly black in R. nigricans Chen & He, 1997, and R. nigridorsum Belokobylskij, 1996 . The infuscate median transverse band of the forewing (Fig. 2 A) is also unique to this species.
Etymology.
Named in honor of Eduardo Mitio Shimbori in recognition of his contributions to Neotropical Rogadinae systematics.
Molecular results
Analysis of the concatenated two gene data set recovers the new species nested within the Old World Rogas representatives, and as sister group to R. roxana from the Russian Far East, though with low support (Fig. 3), and far removed from Triraphis . However, the latter genus was not recovered as monophyletic and its two clades were well separated. The larger clade was entirely comprised of Meso- and South American species whereas the smaller clade largely contained Old World species but also including T. discoideus (Cresson, 1869) from North America and one species, T. robertomirandai Sharkey, 2021, from Costa Rica.